HEXB (NM_001292004) Human Untagged Clone
CAT#: SC335387
HEXB (untagged) - Human hexosaminidase B (beta polypeptide) (HEXB), transcript variant 2
"NM_001292004" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | HEXB |
Synonyms | ENC-1AS; HEL-248; HEL-S-111 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001292004, the custom clone sequence may differ by one or more nucleotides
ATGGCTTTTAATAAGTTTAATGTTCTTCACTGGCACATAGTTGATGACCAGTCTTTCCCATATCAGAGCA TCACTTTTCCTGAGTTAAGCAATAAAGGAAGCTATTCTTTGTCTCATGTTTATACACCAAATGATGTCCG TATGGTGATTGAATATGCCAGATTACGAGGAATTCGAGTCCTGCCAGAATTTGATACCCCTGGGCATACA CTATCTTGGGGAAAAGGTCAGAAAGACCTCCTGACTCCATGTTACAGTAGACAAAACAAGTTGGACTCTT TTGGACCTATAAACCCTACTCTGAATACAACATACAGCTTCCTTACTACATTTTTCAAAGAAATTAGTGA GGTGTTTCCAGATCAATTCATTCATTTGGGAGGAGATGAAGTGGAATTTAAATGTTGGGAATCAAATCCA AAAATTCAAGATTTCATGAGGCAAAAAGGCTTTGGCACAGATTTTAAGAAACTAGAATCTTTCTACATTC AAAAGGTTTTGGATATTATTGCAACCATAAACAAGGGATCCATTGTCTGGCAGGAGGTTTTTGATGATAA AGCAAAGCTTGCGCCGGGCACAATAGTTGAAGTATGGAAAGACAGCGCATATCCTGAGGAACTCAGTAGA GTCACAGCATCTGGCTTCCCTGTAATCCTTTCTGCTCCTTGGTACTTAGATTTGATTAGCTATGGACAAG ATTGGAGGAAATACTATAAAGTGGAACCTCTTGATTTTGGCGGTACTCAGAAACAGAAACAACTTTTCAT TGGTGGAGAAGCTTGTCTATGGGGAGAATATGTGGATGCAACTAACCTCACTCCAAGATTATGGCCTCGG GCAAGTGCTGTTGGTGAGAGACTCTGGAGTTCCAAAGATGTCAGAGATATGGATGACGCCTATGACAGAC TGACAAGGCACCGCTGCAGGATGGTCGAACGTGGAATAGCTGCACAACCTCTTTATGCTGGATATTGTAA CCATGAGAACATGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001292004 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001292004.1, NP_001278933.1 |
RefSeq Size | 2039 bp |
RefSeq ORF | 996 bp |
Locus ID | 3074 |
Cytogenetics | 5q13.3 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Amino sugar and nucleotide sugar metabolism, Glycosaminoglycan degradation, Glycosphingolipid biosynthesis - ganglio series, Glycosphingolipid biosynthesis - globo series, Lysosome, Metabolic pathways, Other glycan degradation |
Gene Summary | 'Hexosaminidase B is the beta subunit of the lysosomal enzyme beta-hexosaminidase that, together with the cofactor GM2 activator protein, catalyzes the degradation of the ganglioside GM2, and other molecules containing terminal N-acetyl hexosamines. Beta-hexosaminidase is composed of two subunits, alpha and beta, which are encoded by separate genes. Both beta-hexosaminidase alpha and beta subunits are members of family 20 of glycosyl hydrolases. Mutations in the alpha or beta subunit genes lead to an accumulation of GM2 ganglioside in neurons and neurodegenerative disorders termed the GM2 gangliosidoses. Beta subunit gene mutations lead to Sandhoff disease (GM2-gangliosidosis type II). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]' Transcript Variant: This variant (2) contains an alternate 5' terminal exon, which causes translation initiation at a downstream AUG start codon, compared to variant 1. The resulting isoform (2) has a shorter N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237493 | HEXB (myc-DDK-tagged) - Human hexosaminidase B (beta polypeptide) (HEXB), transcript variant 2 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review