FDFT1 (NM_001287751) Human Untagged Clone
CAT#: SC335393
FDFT1 (untagged) - Human farnesyl-diphosphate farnesyltransferase 1 (FDFT1), transcript variant 10
"NM_001287751" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | FDFT1 |
Synonyms | DGPT; ERG9; SQS; SQSD; SS |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001287751, the custom clone sequence may differ by one or more nucleotides
ATGACCATCAGTGTGGAAAAGAAGGTCCCGCTGTTACACAACTTTCACTCTTTCCTTTACCAACCAGACT GGCGGTTCATGGAGAGCAAGGAGAAGGATCGCCAGGTGCTGGAGGACTTCCCAACGATCTCCCTTGAGTT TAGAAATCTGGCTGAGAAATACCAAACAGTGATTGCCGACATTTGCCGGAGAATGGGCATTGGGATGGCA GAGTTTTTGGATAAGCATGTGACCTCTGAACAGGAGTGGGACAAGTACTGCCACTATGTTGCTGGGCTGG TCGGAATTGGCCTTTCCCGTCTTTTCTCAGCCTCAGAGTTTGAAGACCCCTTAGTTGGTGAAGATACAGA ACGTGCCAACTCTATGGGCCTGTTTCTGCAGAAAACAAACATCATCCGTGACTATCTGGAAGACCAGCAA GGAGGAAGAGAGTTCTGGCCTCAAGAGGTTTGGAGCAGGTATGTTAAGAAGTTAGGGGATTTTGCTAAGC CGGAGAATATTGACTTGGCCGTGCAGTGCCTGAATGAACTTATAACCAATGCACTGCACCACATCCCAGA TGTCATCACCTACCTTTCGAGACTCAGAAACCAGAGTGTGTTTAACTTCTGTGCTATTCCACAGGTGATG GCCATTGCCACTTTGGCTGCCTGTTATAATAACCAGCAGGTGTTCAAAGGGGCAGTGAAGATTCGGAAAG GGCAAGCAGTGACCCTGATGATGGATGCCACCAATATGCCAGCTGTCAAAGCCATCATATATCAGTATAT GGAAGAGATTTATCATAGAATCCCCGACTCAGACCCATCTTCTAGCAAAACAAGGCAGATCATCTCCACC ATCCGGACGCAGAATCTTCCCAACTGTCAGCTGATTTCCCGAAGCCACTACTCCCCCATCTACCTGTCGT TTGTCATGCTTTTGGCTGCCCTGAGCTGGCAGTACCTGACCACTCTCTCCCAGGTAACAGAAGACTATGT TCAGACTGGAGAACACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001287751 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001287751.1, NP_001274680.1 |
RefSeq Size | 2120 bp |
RefSeq ORF | 999 bp |
Locus ID | 2222 |
Cytogenetics | 8p23.1 |
Protein Families | Druggable Genome |
Protein Pathways | Metabolic pathways, Steroid biosynthesis |
Gene Summary | 'This gene encodes a membrane-associated enzyme located at a branch point in the mevalonate pathway. The encoded protein is the first specific enzyme in cholesterol biosynthesis, catalyzing the dimerization of two molecules of farnesyl diphosphate in a two-step reaction to form squalene. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (10) lacks several exons from the 5' end, contains an alternate 5' terminal exon, and initiates translation from an in-frame downstream start codon compared to variant 1. The resulting isoform (4) has a shorter N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237499 | FDFT1 (myc-DDK-tagged) - Human farnesyl-diphosphate farnesyltransferase 1 (FDFT1), transcript variant 10 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review