LACTB (NM_001288585) Human Untagged Clone

CAT#: SC335399

LACTB (untagged) - Human lactamase, beta (LACTB), transcript variant 3


  "NM_001288585" in other vectors (1)

Reconstitution Protocol

USD 340.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "LACTB"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LACTB
Synonyms G24; MRPL56
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001288585, the custom clone sequence may differ by one or more nucleotides


ATGTACCGGCTCATGTCAGCAGTGACTGCCCGGGCTGCCGCCCCCGGGGGCTTGGCCTCAAGCTGCGGAC
GACGCGGGGTCCATCAGCGCGCCGGGCTGCCGCCTCTCGGCCACGGCTGGGTCGGGGGCCTCGGGCTGGG
GCTGGGGCTGGCGCTCGGGGTGAAGCTGGCAGGTGGGCTGAGGGGCGCGGCCCCGGCGCAGTCCCCCGCG
GCCCCCGACCCTGAGGCGTCGCCTCTGGCCGAGCCGCCACAGGAGCAGTCCCTCGCCCCGTGGTCTCCGC
AGACCCCGGCGCCGCCCTGCTCCAGGTGCTTCGCCAGAGCCATCGAGAGCAGCCGCGACCTGCTGCACAG
GATCAAGGATGAGGTGGGCGCACCGGGCATAGTGGTTGGAGTTTCTGTAGATGGAAAAGAAGTCTGGTCA
GAAGGTTTAGGTTATGCTGATGTTGAGAACCGTGTACCATGTAAACCAGAGACAGTTATGCGAATTGCTA
GCATCAGCAAAAGTCTCACCATGGTTGCTCTTGCCAAATTGTGGGAAGCAGGGAAACTGGATCTTGATAT
TCCAGTACAACATTATGTTCCCGAATTCCCAGAAAAAGAATATGAAGGTGAAAAGGTTTCTGTCACAACA
AGATTACTGATTTCCCATTTAAGTGGAATTCGTCATTATGAAAAGGACATAAAAAAGGTGAAAGAAGAGA
AAGCTTATAAAGCCTTGAAGATGATGAAAGAGAATGTTGCATTTGAGCAAGAAAAAGAAGGCAAAAGTAA
TGAAAAGAATGATTTTACTAAATTTAAAACAGAGCAGGAGAATGAAGCCAAATGCCGGAATTCAAAACCT
GGCAAGAAAAAGAATGATTTTGAACAAGGCGAATTATATTTGAGAGAAAAGTTTGAAAATTCAATTGAAT
CCCTAAGATTATTTAAAAATGATCCTTTGTTCTTCAAACCTGTCAGTTTTTGTATTCAACTTTTGGCTAT
ACCCTACTGGCAGCCATAG


Restriction Sites SgfI-MluI     
ACCN NM_001288585
ORF Size 999 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001288585.1, NP_001275514.1
RefSeq Size 3007
RefSeq ORF 999
Locus ID 114294
Protein Families Protease
Gene Summary This gene encodes a mitochondrially-localized protein that has sequence similarity to prokaryotic beta-lactamases. Many of the residues responsible for beta-lactamase activity are not conserved in this protein, suggesting it may have a different enzymatic function. Increased expression of the related mouse gene was found to be associated with obesity. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Dec 2013]
Transcript Variant: This variant (3) contains multiple differences in the 3' coding region and 3' UTR, compared to variant 1, one of which results in a frameshift. The encoded isoform (c) has a distinct C-terminus and is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.