GNB3 (NM_001297571) Human Untagged Clone

CAT#: SC335459

GNB3 (untagged) - Human guanine nucleotide binding protein (G protein), beta polypeptide 3 (GNB3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GNB3
• Synonyms: CSNB1H
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001297571, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGGGAGATGGAGCAACTGCGTCAGGAAGCGGAGCAGCTCAAGAAGCAGATTGCAGATGCCAGGAAAG
  CCTGTGCTGACGTTACTCTGGCAGAGCTGGTGTCTGGCCTAGAGGTGGTGGGACGAGTCCAGATGCGGAC
  GCGGCGGACGTTAAGGGGACACCTGGCCAAGATTTACGCCATGCACTGGGCCACTGATTCTAAGCTGCTG
  GTAAGTGCCTCGCAAGATGGGAAGCTGATCGTGTGGGACAGCTACACCACCAACAAGGTGCACGCCATCC
  CACTGCGCTCCTCCTGGGTCATGACCTGTGCCTATGCCCCATCAGGGAACTTTGTGGCATGTGGGGGGCT
  GGACAACATGTGTTCCATCTACAACCTCAAATCCCGTGAGGGCAATGTCAAGGTCAGCCGGGAGCTTTCT
  GCTCACACAGGTTATCTCTCCTGCTGCCGCTTCCTGGATGACAACAATATTGTGACCAGCTCGGGGGACA
  CCACTGCCTTGTGGGACATTGAGACTGGGCAGCAGAAGACTGTATTTGTGGGACACACGGGTGACTGCAT
  GAGCCTGGCTGTGTCTCCTGACTTCAATCTCTTCATTTCGGGGGCCTGTGATGCCAGTGCCAAGCTCTGG
  GATGTGCGAGAGGGGACCTGCCGTCAGACTTTCACTGGCCACGAGTCGGACATCAACGCCATCTGTTTCT
  TCCCCAATGGAGAGGCCATCTGCACGGGCTCGGATGACGCTTCCTGCCGCTTGTTTGACCTGCGGGCAGA
  CCAGGAGCTGATCTGCTTCTCCCACGAGAGCATCATCTGCGGCATCACGTCCGTGGCCTTCTCCCTCAGT
  GGCCGCCTACTATTCGCTGGCTACGACGACTTCAACTGCAATGTCTGGGACTCCATGAAGTCTGAGCGTG
  TGGGCATCCTCTCTGGCCACGATAACAGGGTGAGCTGCCTGGGAGTCACAGCTGACGGGATGGCTGTGGC
  CACAGGTTCCTGGGACAGCTTCCTCAAAATCTGGAACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001297571
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001297571.1, NP_001284500.1
• RefSeq Size: 1757 bp
• RefSeq ORF: 1020 bp
• Locus ID: 2784
• Cytogenetics: 12p13.31
• Protein Families: Druggable Genome
• Protein Pathways: Chemokine signaling pathway, Taste transduction
• Gene Summary: 'Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit which belongs to the WD repeat G protein beta family. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. A single-nucleotide polymorphism (C825T) in this gene is associated with essential hypertension and obesity. This polymorphism is also associated with the occurrence of the splice variant GNB3-s, which appears to have increased activity. GNB3-s is an example of alternative splicing caused by a nucleotide change outside of the splice donor and acceptor sites. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jul 2014]'
  Transcript Variant: This variant (2) uses an alternate in-frame splice site, in the central coding region, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.