P2RX4 (NM_001261398) Human Untagged Clone

CAT#: SC335476

P2RX4 (untagged) - Human purinergic receptor P2X, ligand-gated ion channel, 4 (P2RX4), transcript variant 6

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: P2RX4
• Synonyms: P2X4; P2X4R
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001261398, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGGCTGCTGCGCCGCGCTGGCGGCCTTCCTGTTCGAGTACGACACGCCGCGCATCGTGCTCATCC
  GCAGCCGCAAAGTGGGGCTCATGAACCGCGCCGTGCAACTGCTCATCCTGGCCTACGTCATCGGGTGGGT
  GTTTGTGTGGGAAAAGGGCTACCAGGAAACTGACTCCGTGGTCAGCTCCGTTACGACCAAGGTCAAGGGC
  GTGGCTGTGACCAACACTTCTAAACTTGGATTCCGGATCTGGGATGTGGCGGATTATGTGATACCAGCTC
  AGGAGGAAAACTCCCTCTTCGTCATGACCAACGTGATCCTCACCATGAACCAGACACAGGGCCTGTGCCC
  CGAGATTCCAGATGCGACCACTGTGTGTAAATCAGATGCCAGCTGTACTGCCGGCTCTGCCGGCACCCAC
  AGCAACGGAGTCTCAACAGGCAGGTGCGTAGCTTTCAACGGGTCTGTCAAGACGTGTGAGGTGGCGGCCT
  GGTGCCCGGTGGAGGATGACACACACGTGCCACAACCTGCTTTTTTAAAGGCTGCAGAAAACTTCACTCT
  TTTGGTTAAGAACAACATCTGGTATCCCAAATTTAATTTCAGCAAGAGGAATATCCTTCCCAACATCACC
  ACTACTTACCTCAAGTCGTGCATTTATGATGCTAAAACAGATCCCTTCTGCCCCATATTCCGTCTTGGCA
  AAATAGTGGAGAACGCAGGACACAGTTTCCAGGACATGGCCGTGGAGGGAGGCATCATGGGCATCCAGGT
  CAACTGGGACTGCAACCTGGACAGAGCCGCCTCCCTCTGCTTGCCCAGGTACTCCTTCCGCCGCCTCGAT
  ACACGGGACGTTGAGCACAACGTATCTCCTGGCTACAATTTCAGGTTTGCCAAGTACTACAGAGACCTGG
  CTGGCAACGAGCAGCGCACGCTCATCAAGGCCTATGGCATCCGCTTCGACATCATTGTGTTTGGGAAGGC
  AGGGAAATTTGACATCACCCCAGAGAAATTTCTGGAATCTGATTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001261398
• ORF Size: 1026 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001261398.1, NP_001248327.1
• RefSeq Size: 1796
• RefSeq ORF: 1026
• Locus ID: 5025
• Protein Families: Druggable Genome, Ion Channels: ATP Receptors, Transmembrane
• Protein Pathways: Calcium signaling pathway, Neuroactive ligand-receptor interaction
• Gene Summary: The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel with high calcium permeability. The main pharmacological distinction between the members of the purinoceptor family is the relative sensitivity to the antagonists suramin and PPADS. The product of this gene has the lowest sensitivity for these antagonists. Multiple alternatively spliced transcript variants, some protein-coding and some not protein-coding, have been found for this gene. [provided by RefSeq, Feb 2012]
  Transcript Variant: This variant (6) lacks an in-frame exon in the 5' coding region and a segment in the 3' region, compared to variant 1. The resulting isoform (4) lacks an internal segment and has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.