P2RX4 (NM_001261398) Human Untagged Clone

CAT#: SC335476

P2RX4 (untagged) - Human purinergic receptor P2X, ligand-gated ion channel, 4 (P2RX4), transcript variant 6


  "NM_001261398" in other vectors (1)

Reconstitution Protocol

USD 350.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "P2RX4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol P2RX4
Synonyms P2X4; P2X4R
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001261398, the custom clone sequence may differ by one or more nucleotides


ATGGCGGGCTGCTGCGCCGCGCTGGCGGCCTTCCTGTTCGAGTACGACACGCCGCGCATCGTGCTCATCC
GCAGCCGCAAAGTGGGGCTCATGAACCGCGCCGTGCAACTGCTCATCCTGGCCTACGTCATCGGGTGGGT
GTTTGTGTGGGAAAAGGGCTACCAGGAAACTGACTCCGTGGTCAGCTCCGTTACGACCAAGGTCAAGGGC
GTGGCTGTGACCAACACTTCTAAACTTGGATTCCGGATCTGGGATGTGGCGGATTATGTGATACCAGCTC
AGGAGGAAAACTCCCTCTTCGTCATGACCAACGTGATCCTCACCATGAACCAGACACAGGGCCTGTGCCC
CGAGATTCCAGATGCGACCACTGTGTGTAAATCAGATGCCAGCTGTACTGCCGGCTCTGCCGGCACCCAC
AGCAACGGAGTCTCAACAGGCAGGTGCGTAGCTTTCAACGGGTCTGTCAAGACGTGTGAGGTGGCGGCCT
GGTGCCCGGTGGAGGATGACACACACGTGCCACAACCTGCTTTTTTAAAGGCTGCAGAAAACTTCACTCT
TTTGGTTAAGAACAACATCTGGTATCCCAAATTTAATTTCAGCAAGAGGAATATCCTTCCCAACATCACC
ACTACTTACCTCAAGTCGTGCATTTATGATGCTAAAACAGATCCCTTCTGCCCCATATTCCGTCTTGGCA
AAATAGTGGAGAACGCAGGACACAGTTTCCAGGACATGGCCGTGGAGGGAGGCATCATGGGCATCCAGGT
CAACTGGGACTGCAACCTGGACAGAGCCGCCTCCCTCTGCTTGCCCAGGTACTCCTTCCGCCGCCTCGAT
ACACGGGACGTTGAGCACAACGTATCTCCTGGCTACAATTTCAGGTTTGCCAAGTACTACAGAGACCTGG
CTGGCAACGAGCAGCGCACGCTCATCAAGGCCTATGGCATCCGCTTCGACATCATTGTGTTTGGGAAGGC
AGGGAAATTTGACATCACCCCAGAGAAATTTCTGGAATCTGATTGA


Restriction Sites SgfI-MluI     
ACCN NM_001261398
ORF Size 1026 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001261398.1, NP_001248327.1
RefSeq Size 1796
RefSeq ORF 1026
Locus ID 5025
Protein Families Druggable Genome, Ion Channels: ATP Receptors, Transmembrane
Protein Pathways Calcium signaling pathway, Neuroactive ligand-receptor interaction
Gene Summary The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel with high calcium permeability. The main pharmacological distinction between the members of the purinoceptor family is the relative sensitivity to the antagonists suramin and PPADS. The product of this gene has the lowest sensitivity for these antagonists. Multiple alternatively spliced transcript variants, some protein-coding and some not protein-coding, have been found for this gene. [provided by RefSeq, Feb 2012]
Transcript Variant: This variant (6) lacks an in-frame exon in the 5' coding region and a segment in the 3' region, compared to variant 1. The resulting isoform (4) lacks an internal segment and has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.