Aurora B (AURKB) (NM_001284526) Human Untagged Clone

CAT#: SC335506

AURKB (untagged) - Human aurora kinase B (AURKB), transcript variant 3


  "NM_001284526" in other vectors (1)

Reconstitution Protocol

USD 350.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "AURKB"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol AURKB
Synonyms AIK2; AIM-1; AIM1; ARK-2; ARK2; AurB; aurkb-sv1; aurkb-sv2; IPL1; PPP1R48; STK-1; STK5; STK12
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001284526, the custom clone sequence may differ by one or more nucleotides


ATGGCCCAGAAGGAGAACTCCTACCCCTGGCCCTACGGCCGACAGACGGCTCCATCTGGCCTGAGCACCC
TGCCCCAGCGAGTCCTCCGGAAAGAGCCTGTCACCCCATCTGCACTTGTCCTCATGAGCCGCTCCAATGT
CCAGCCCACAGCTGCCCCTGGCCAGAAGGTGATGGAGAATAGCAGTGGGACACCCGACATCTTAACCAGG
CGGCACTTCACAATTGATGACTTTGAGATTGGGCGTCCTCTGGGCAAAGGCAAGTTTGGAAACGTGTACT
TGGCTCGGGAGAAGAAAAGCCATTTCATCGTGGCGCTCAAGGTCCTCTTCAAGTCCCAGATAGAGAAGGA
GGGCGTGGAGCATCAGCTGCGCAGAGAGATCGAAATCCAGGCCCACCTGCACCATCCCAACATCCTGCGT
CTCTACAACTATTTTTATGACCGGAGGAGGATCTACTTGATTCTAGAGTATGCCCCCCGCGGGGAGCTCT
ACAAGGAGCTGCAGAAGAGCTGCACATTTGACGAGCAGCGAACAGCCACGATCATGGAGGAGTTGGCAGA
TGCTCTAATGTACTGCCATGGGAAGAAGGTGATTCACAGAGACATAAAGCCAGAAAATCTGCTCTTAGGG
CTCAAGGGAGAGCTGAAGATTGCTGACTTCGGCTGGTCTGTGCATGCGCCCTCCCTGAGGAGGAAGACAA
TGTGTGGCACCCTGGACTACCTGCCCCCAGAGATGATTGAGGGGCGCATGCACAATGAGAAGGTGGATCT
GTGGTGCATTGGAGTGCTTTGCTATGAGCTGCTGGTGGGGAACCCACCCTTTGAGAGTGCATCACACAAC
GAGACCTATCGCCGCATCGTCAAGGTGGACCTAAAGTTCCCCGCTTCCGTGCCCATGGGAGCCCAGGACC
TCATCTCCAAACTGCTCAGGCATAACCCCTCGGAACGGCTGCCCCTGGCCCAGGTCTCAGCCCACCCTTG
GGTCCGGGCCAACTCTCGGAGGGTGCTGCCTCCCTCTGCCCTTCAATCTGTCGCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001284526
ORF Size 1038 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001284526.1, NP_001271455.1
RefSeq Size 1317
RefSeq ORF 1038
Locus ID 9212
Protein Families Druggable Genome, Protein Kinase, Stem cell - Pluripotency
Gene Summary This gene encodes a member of the aurora kinase subfamily of serine/threonine kinases. The genes encoding the other two members of this subfamily are located on chromosomes 19 and 20. These kinases participate in the regulation of alignment and segregation of chromosomes during mitosis and meiosis through association with microtubules. A pseudogene of this gene is located on chromosome 8. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
Transcript Variant: This variant (3) uses an alternate in-frame acceptor splice site in the mid-coding region compared to variant 1. The resulting isoform (3) is one amino acid longer than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.