FDFT1 (NM_001287748) Human Untagged Clone

CAT#: SC335559

FDFT1 (untagged) - Human farnesyl-diphosphate farnesyltransferase 1 (FDFT1), transcript variant 7


  "NM_001287748" in other vectors (1)

Reconstitution Protocol

USD 360.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "FDFT1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FDFT1
Synonyms DGPT; ERG9; SQS; SQSD; SS
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001287748, the custom clone sequence may differ by one or more nucleotides


ATGCGCAACGCAGTGTGCATATTTTATCTGGTTCTCCGAGCTCTGGACACACTGGAAGATGACATGACCA
TCAGTGTGGAAAAGAAGGTCCCGCTGTTACACAACTTTCACTCTTTCCTTTACCAACCAGACTGGCGGTT
CATGGAGAGCAAGGAGAAGGATCGCCAGGTGCTGGAGGACTTCCCAACGATCTCCCTTGAGTTTAGAAAT
CTGGCTGAGAAATACCAAACAGTGATTGCCGACATTTGCCGGAGAATGGGCATTGGGATGGCAGAGTTTT
TGGATAAGCATGTGACCTCTGAACAGGAGTGGGACAAGTACTGCCACTATGTTGCTGGGCTGGTCGGAAT
TGGCCTTTCCCGTCTTTTCTCAGCCTCAGAGTTTGAAGACCCCTTAGTTGGTGAAGATACAGAACGTGCC
AACTCTATGGGCCTGTTTCTGCAGAAAACAAACATCATCCGTGACTATCTGGAAGACCAGCAAGGAGGAA
GAGAGTTCTGGCCTCAAGAGGTTTGGAGCAGGTATGTTAAGAAGTTAGGGGATTTTGCTAAGCCGGAGAA
TATTGACTTGGCCGTGCAGTGCCTGAATGAACTTATAACCAATGCACTGCACCACATCCCAGATGTCATC
ACCTACCTTTCGAGACTCAGAAACCAGAGTGTGTTTAACTTCTGTGCTATTCCACAGGTGATGGCCATTG
CCACTTTGGCTGCCTGTTATAATAACCAGCAGGTGTTCAAAGGGGCAGTGAAGATTCGGAAAGGGCAAGC
AGTGACCCTGATGATGGATGCCACCAATATGCCAGCTGTCAAAGCCATCATATATCAGTATATGGAAGAG
ATTTATCATAGAATCCCCGACTCAGACCCATCTTCTAGCAAAACAAGGCAGATCATCTCCACCATCCGGA
CGCAGAATCTTCCCAACTGTCAGCTGATTTCCCGAAGCCACTACTCCCCCATCTACCTGTCGTTTGTCAT
GCTTTTGGCTGCCCTGAGCTGGCAGTACCTGACCACTCTCTCCCAGGTAACAGAAGACTATGTTCAGACT
GGAGAACACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001287748
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001287748.1, NP_001274677.1
RefSeq Size 2008 bp
RefSeq ORF 1062 bp
Locus ID 2222
Cytogenetics 8p23.1
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Steroid biosynthesis
Gene Summary 'This gene encodes a membrane-associated enzyme located at a branch point in the mevalonate pathway. The encoded protein is the first specific enzyme in cholesterol biosynthesis, catalyzing the dimerization of two molecules of farnesyl diphosphate in a two-step reaction to form squalene. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (7) differs at the 5' end and initiates translation from an in-frame downstream start codon compared to variant 1. The resulting isoform (2) has a shorter N-terminus compared to isoform 1. Variants 4-8 encode the same isoform.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.