Acid Phosphatase 2 (ACP2) (NM_001302491) Human Untagged Clone

CAT#: SC335613

ACP2 (untagged) - Human acid phosphatase 2, lysosomal (ACP2), transcript variant 5


  "NM_001302491" in other vectors (1)

Reconstitution Protocol

USD 360.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "ACP2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ACP2
Synonyms LAP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001302491, the custom clone sequence may differ by one or more nucleotides


ATGGCGGGCAAGCGGTCCGGCTGGAGCCGGGCGGCTCTCCTCCAGCTCCTTCTCGGCGTGAACCTGGTGG
TGATGCCGCCCACCCGGGCCCGGAGTCTGCGCTTCGTTACCTTGCTGTACCGCCATGGAGACCGTTCACC
AGTGAAGACATATCCCAAGGACCCCTATCAGGAAGAAGAATGGCCCCAGGGGTTTGGTCAGTTAACCAAG
GAGGGGATGCTACAGCACTGGGAACTGGGCCAGGCCCTGCGGCAGCGCTATCACGGCTTCCTAAACACCT
CTTATCACCGGCAAGAGGTTTATGTGCGAAGCACAGACTTTGACCGGACTCTCATGAGTGCTGAGGCCAA
CCTGGCTGGACTCTTCCCTCCCAACGGGATGCAGCGCTTCAACCCGAACATCTCGTGGCAGCCTATTCCT
GTGCACACTGTGCCCATCACTGAGGACAGGCAAACGCACGGGCTGCGCCTGCCGCCCTGGGCCTCACCCC
AAACCATGCAGCGTCTCAGCCGGCTAAAGGACTTCAGCTTCCGCTTCCTCTTCGGAATCTACCAGCAGGC
GGAGAAGGCCCGGCTTCAGGGGGGAGTCCTGCTGGCTCAGATAAGGAAGAACCTGACCCTAATGGCGACC
ACCTCCCAGCTCCCCAAGCTGCTGGTTTACTCTGCGCACGACACTACCCTGGTTGCCCTGCAAATGGCAC
TGGATGTCTACAATGGTGAACAAGCCCCCTACGCCTCCTGCCACATATTTGAACTGTACCAGGAAGATTC
TGGGAATTTCTCAGTGGAGATGTACTTTCGGAACGAGAGTGACAAGGCCCCCTGGCCGCTCAGCCTGCCT
GGCTGCCCTCACCGCTGCCCACTGCAGGACTTCCTTCGCCTCACAGAGCCCGTCGTGCCCAAGGATTGGC
AGCAGGAGTGCCAGCTGGCAAGCGGTCCTGCAGACACAGAGGTGATTGTGGCCTTGGCTGTATGTGGCTC
CATCCTCTTCCTCCTCATAGTGCTGCTCCTCACCGTCCTCTTCCGGATGCAGGCCCAGCCTCCTGGCTAC
CGCCACGTCGCAGATGGGGAGGACCACGCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001302491
ORF Size 1083 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001302491.1, NP_001289420.1
RefSeq Size 1970
RefSeq ORF 1083
Locus ID 53
Protein Families Druggable Genome, Transmembrane
Protein Pathways Lysosome, Riboflavin metabolism
Gene Summary The protein encoded by this gene belongs to the histidine acid phosphatase family, which hydrolyze orthophosphoric monoesters to alcohol and phosphate. This protein is localized to the lysosomal membrane, and is chemically and genetically distinct from the red cell acid phosphatase. Mice lacking this gene showed multiple defects, including bone structure alterations, lysosomal storage defects, and an increased tendency towards seizures. An enzymatically-inactive allele of this gene in mice showed severe growth retardation, hair-follicle abnormalities, and an ataxia-like phenotype. Alternatively spliced transcript variants have been found for this gene. A C-terminally extended isoform is also predicted to be produced by the use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism. [provided by RefSeq, Oct 2017]
Transcript Variant: This variant (5) lacks two consecutive in-frame exons in the 5' coding region compared to variant 1. The encoded shorter isoform (5) lacks an internal protein segment compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.