AZIN2 (NM_001301823) Human Untagged Clone

CAT#: SC335631

AZIN2 (untagged) - Human antizyme inhibitor 2 (AZIN2), transcript variant 3


  "NM_001301823" in other vectors (1)

Reconstitution Protocol

USD 370.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "AZIN2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol AZIN2
Synonyms ADC; AZI2; AZIB1; ODC-p; ODC1L; ODCp
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001301823, the custom clone sequence may differ by one or more nucleotides


ATGGAGTTGGTCCAGCATATTGGAATCCCTGCCAGTAAGATCATCTGCGCCAACCCCTGTAAGCAAATTG
CACAGATCAAATATGCTGCCAAGCATGGGATCCAGCTGCTGAGCTTTGACAATGAGATGGAGCTGGCAAA
GGTGGTAAAGAGCCACCCCAGTGCCAAGATGGTTCTGTGCATTGCTACCGATGACTCCCACTCCCTGAGC
TGCCTGAGCCTAAAGTTTGGAGTGTCACTGAAATCCTGCAGACACCTGCTTGAAAATGCGAAGAAGCACC
ATGTGGAGGTGGTGGGTGTGAGTTTTCACATTGGCAGTGGCTGTCCTGACCCTCAGGCCTATGCTCAGTC
CATCGCAGACGCCCGGCTCGTGTTTGAAATGGGCACCGAGCTGGGTCACAAGATGCACGTTCTGGACCTT
GGTGGTGGCTTCCCTGGCACAGAAGGGGCCAAAGTGAGATTTGAAGAGATTGCTTCCGTGATCAACTCAG
CCTTGGACCTGTACTTCCCAGAGGGCTGTGGCGTGGACATCTTTGCTGAGCTGGGGCGCTACTACGTGAC
CTCGGCCTTCACTGTGGCAGTCAGCATCATTGCCAAGAAGGAGGTTCTGCTAGACCAGCCTGGCAGGGAG
GAGGAAAATGGTTCCACCTCCAAGACCATCGTGTACCACCTTGATGAGGGCGTGTATGGGATCTTCAACT
CAGTCCTGTTTGACAACATCTGCCCTACCCCCATCCTGCAGAAGAAACCATCCACGGAGCAGCCCCTGTA
CAGCAGCAGCCTGTGGGGCCCGGCGGTTGATGGCTGTGATTGCGTGGCTGAGGGCCTGTGGCTGCCGCAA
CTACACGTAGGGGACTGGCTGGTCTTTGACAACATGGGCGCCTACACTGTGGGCATGGGTTCCCCCTTTT
GGGGGACCCAGGCCTGCCACATCACCTATGCCATGTCCCGGGTGGCCTGGGAAGCGCTGCGAAGGCAGCT
GATGGCTGCAGAACAGGAGGATGACGTGGAGGGTGTGTGCAAGCCTCTGTCCTGCGGCTGGGAGATCACA
GACACCCTGTGCGTGGGCCCTGTCTTCACCCCAGCGAGCATCATGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001301823
ORF Size 1098 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001301823.1, NP_001288752.1
RefSeq Size 2023
RefSeq ORF 1098
Locus ID 113451
Protein Families Druggable Genome
Protein Pathways Arginine and proline metabolism, Metabolic pathways
Gene Summary The protein encoded by this gene belongs to the antizyme inhibitor family, which plays a role in cell growth and proliferation by maintaining polyamine homeostasis within the cell. Antizyme inhibitors are homologs of ornithine decarboxylase (ODC, the key enzyme in polyamine biosynthesis) that have lost the ability to decarboxylase ornithine; however, retain the ability to bind to antizymes. Antizymes negatively regulate intracellular polyamine levels by binding to ODC and targeting it for degradation, as well as by inhibiting polyamine uptake. Antizyme inhibitors function as positive regulators of polyamine levels by sequestering antizymes and neutralizing their effect. This gene encodes antizyme inhibitor 2, the second member of this gene family. Like antizyme inhibitor 1, antizyme inhibitor 2 interacts with all 3 antizymes and stimulates ODC activity and polyamine uptake. However, unlike antizyme inhibitor 1, which is ubiquitously expressed and localized in the nucleus and cytoplasm, antizyme inhibitor 2 is predominantly expressed in the brain and testis and localized in the endoplasmic reticulum-golgi intermediate compartment. Recent studies indicate that antizyme inhibitor 2 is also expressed in specific cell types in ovaries, adrenal glands and pancreas, and in mast cells. The exact function of this gene is not known, however, available data suggest its role in cell growth, spermiogenesis, vesicular trafficking and secretion. Accumulation of antizyme inhibitor 2 has also been observed in brains of patients with Alzheimer's disease. There has been confusion in literature and databases over the nomenclature of this gene, stemming from an earlier report that a human cDNA clone (identical to ODCp/AZIN2) had arginine decarboxylase (ADC) activity (PMID:14738999). Subsequent studies in human and mouse showed that antizyme inhibitor 2 was devoid of arginine decarboxylase activity (PMID:19956990). Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Sep 2014]
Transcript Variant: This variant (3) has multiple differences at the 5' end, which result in a distinct 5' UTR and translation initiation from an in-frame downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform 1. Variants 3, 4, 8, 9, 10 and 11 encode the same isoform (2).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.