AZIN2 (NM_001301824) Human Untagged Clone
CAT#: SC335632
AZIN2 (untagged) - Human antizyme inhibitor 2 (AZIN2), transcript variant 4
"NM_001301824" in other vectors (1)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | AZIN2 |
Synonyms | ADC; AZI2; AZIB1; ODC-p; ODC1L; ODCp |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001301824, the custom clone sequence may differ by one or more nucleotides
ATGGAGTTGGTCCAGCATATTGGAATCCCTGCCAGTAAGATCATCTGCGCCAACCCCTGTAAGCAAATTG CACAGATCAAATATGCTGCCAAGCATGGGATCCAGCTGCTGAGCTTTGACAATGAGATGGAGCTGGCAAA GGTGGTAAAGAGCCACCCCAGTGCCAAGATGGTTCTGTGCATTGCTACCGATGACTCCCACTCCCTGAGC TGCCTGAGCCTAAAGTTTGGAGTGTCACTGAAATCCTGCAGACACCTGCTTGAAAATGCGAAGAAGCACC ATGTGGAGGTGGTGGGTGTGAGTTTTCACATTGGCAGTGGCTGTCCTGACCCTCAGGCCTATGCTCAGTC CATCGCAGACGCCCGGCTCGTGTTTGAAATGGGCACCGAGCTGGGTCACAAGATGCACGTTCTGGACCTT GGTGGTGGCTTCCCTGGCACAGAAGGGGCCAAAGTGAGATTTGAAGAGATTGCTTCCGTGATCAACTCAG CCTTGGACCTGTACTTCCCAGAGGGCTGTGGCGTGGACATCTTTGCTGAGCTGGGGCGCTACTACGTGAC CTCGGCCTTCACTGTGGCAGTCAGCATCATTGCCAAGAAGGAGGTTCTGCTAGACCAGCCTGGCAGGGAG GAGGAAAATGGTTCCACCTCCAAGACCATCGTGTACCACCTTGATGAGGGCGTGTATGGGATCTTCAACT CAGTCCTGTTTGACAACATCTGCCCTACCCCCATCCTGCAGAAGAAACCATCCACGGAGCAGCCCCTGTA CAGCAGCAGCCTGTGGGGCCCGGCGGTTGATGGCTGTGATTGCGTGGCTGAGGGCCTGTGGCTGCCGCAA CTACACGTAGGGGACTGGCTGGTCTTTGACAACATGGGCGCCTACACTGTGGGCATGGGTTCCCCCTTTT GGGGGACCCAGGCCTGCCACATCACCTATGCCATGTCCCGGGTGGCCTGGGAAGCGCTGCGAAGGCAGCT GATGGCTGCAGAACAGGAGGATGACGTGGAGGGTGTGTGCAAGCCTCTGTCCTGCGGCTGGGAGATCACA GACACCCTGTGCGTGGGCCCTGTCTTCACCCCAGCGAGCATCATGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001301824 |
ORF Size | 1098 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001301824.1, NP_001288753.1 |
RefSeq Size | 1849 |
RefSeq ORF | 1098 |
Locus ID | 113451 |
Protein Families | Druggable Genome |
Protein Pathways | Arginine and proline metabolism, Metabolic pathways |
Gene Summary | The protein encoded by this gene belongs to the antizyme inhibitor family, which plays a role in cell growth and proliferation by maintaining polyamine homeostasis within the cell. Antizyme inhibitors are homologs of ornithine decarboxylase (ODC, the key enzyme in polyamine biosynthesis) that have lost the ability to decarboxylase ornithine; however, retain the ability to bind to antizymes. Antizymes negatively regulate intracellular polyamine levels by binding to ODC and targeting it for degradation, as well as by inhibiting polyamine uptake. Antizyme inhibitors function as positive regulators of polyamine levels by sequestering antizymes and neutralizing their effect. This gene encodes antizyme inhibitor 2, the second member of this gene family. Like antizyme inhibitor 1, antizyme inhibitor 2 interacts with all 3 antizymes and stimulates ODC activity and polyamine uptake. However, unlike antizyme inhibitor 1, which is ubiquitously expressed and localized in the nucleus and cytoplasm, antizyme inhibitor 2 is predominantly expressed in the brain and testis and localized in the endoplasmic reticulum-golgi intermediate compartment. Recent studies indicate that antizyme inhibitor 2 is also expressed in specific cell types in ovaries, adrenal glands and pancreas, and in mast cells. The exact function of this gene is not known, however, available data suggest its role in cell growth, spermiogenesis, vesicular trafficking and secretion. Accumulation of antizyme inhibitor 2 has also been observed in brains of patients with Alzheimer's disease. There has been confusion in literature and databases over the nomenclature of this gene, stemming from an earlier report that a human cDNA clone (identical to ODCp/AZIN2) had arginine decarboxylase (ADC) activity (PMID:14738999). Subsequent studies in human and mouse showed that antizyme inhibitor 2 was devoid of arginine decarboxylase activity (PMID:19956990). Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Sep 2014] Transcript Variant: This variant (4) has multiple differences at the 5' end, which result in a distinct 5' UTR and translation initiation from an in-frame downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform 1. Variants 3, 4, 8, 9, 10 and 11 encode the same isoform (2). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237738 | AZIN2 (myc-DDK-tagged) - Human antizyme inhibitor 2 (AZIN2), transcript variant 4 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review