GDF 9 (GDF9) (NM_001288824) Human Untagged Clone
CAT#: SC335640
GDF9 (untagged) - Human growth differentiation factor 9 (GDF9), transcript variant 2
"NM_001288824" in other vectors (1)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GDF9 |
Synonyms | POF14 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001288824, the custom clone sequence may differ by one or more nucleotides
ATGAAGAAGCTCTATAAGACATATGCTACCAAGGAAGGGATTCCTAAATCCAATAGAAGTCACCTCTACA ACACTGTTCGGCTCTTCACCCCCTGTACCCGGCACAAGCAGGCTCCTGGAGACCAGGTAACAGGAATCCT TCCATCAGTGGAACTGCTATTTAACCTGGATCGCATTACTACCGTTGAACACTTACTCAAGTCAGTCTTG CTGTACAATATCAACAACTCAGTTTCTTTTTCCTCTGCTGTCAAATGTGTGTGCAATCTAATGATAAAGG AGCCAAAGTCTTCTAGCAGGACTCTCGGCAGAGCTCCATACTCATTTACCTTTAACTCACAGTTTGAATT TGGAAAGAAACACAAATGGATTCAGATTGATGTGACCAGCCTCCTTCAACCTTTAGTGGCCTCCAACAAG AGAAGTATTCACATGTCTATAAATTTTACTTGCATGAAAGACCAGCTGGAGCATCCTTCAGCACAGAATG GTTTGTTTAACATGACTCTGGTGTCCCCCTCACTGATCTTATATTTGAATGACACAAGTGCTCAGGCTTA TCACAGCTGGTATTCCCTTCACTATAAAAGGAGGCCTTCCCAGGGTCCTGACCAGGAGAGAAGTCTGTCT GCCTATCCTGTGGGAGAAGAGGCTGCTGAGGATGGGAGATCTTCCCATCACCGTCACCGCAGAGGTCAGG AAACTGTCAGTTCTGAATTGAAGAAGCCCTTGGGCCCAGCTTCCTTCAATCTGAGTGAATACTTCAGACA ATTTCTTCTTCCCCAAAATGAGTGTGAGCTCCATGACTTTAGACTTAGCTTTAGTCAGCTGAAGTGGGAC AACTGGATTGTGGCTCCGCACAGGTACAACCCTCGATACTGTAAAGGGGACTGTCCAAGGGCAGTTGGAC ATCGGTATGGCTCTCCAGTTCACACCATGGTACAGAACATCATCTATGAGAAGCTGGACTCCTCAGTGCC AAGACCGTCATGTGTACCTGCCAAATACAGCCCCTTGAGTGTTTTGACCATTGAGCCCGATGGCTCAATT GCCTATAAAGAGTACGAAGATATGATAGCTACAAAGTGCACCTGTCGTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001288824 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001288824.2, NP_001275753.1 |
RefSeq Size | 1832 bp |
RefSeq ORF | 1101 bp |
Locus ID | 2661 |
Cytogenetics | 5q31.1 |
Protein Families | Adult stem cells, Cancer stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Secreted Protein, Stem cell - Pluripotency, Stem cell relevant signaling - TGFb/BMP signaling pathway, Transmembrane |
Gene Summary | 'This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates ovarian function. Reduced expression of this gene may be associated with polycystic ovary syndrome and mutations in this gene may be more common in mothers of dizygotic twins. [provided by RefSeq, Jul 2016]' Transcript Variant: This variant (2) contains an alternate exon in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus than isoform 1. Variants 2, 3, 4, 5, and 6 encode the same isoform (2). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237746 | GDF9 (myc-DDK-tagged) - Human growth differentiation factor 9 (GDF9), transcript variant 2 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review