GDF 9 (GDF9) (NM_001288826) Human Untagged Clone

CAT#: SC335642

GDF9 (untagged) - Human growth differentiation factor 9 (GDF9), transcript variant 4


  "NM_001288826" in other vectors (1)

Reconstitution Protocol

USD 370.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "GDF9"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GDF9
Synonyms POF14
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001288826, the custom clone sequence may differ by one or more nucleotides


ATGAAGAAGCTCTATAAGACATATGCTACCAAGGAAGGGATTCCTAAATCCAATAGAAGTCACCTCTACA
ACACTGTTCGGCTCTTCACCCCCTGTACCCGGCACAAGCAGGCTCCTGGAGACCAGGTAACAGGAATCCT
TCCATCAGTGGAACTGCTATTTAACCTGGATCGCATTACTACCGTTGAACACTTACTCAAGTCAGTCTTG
CTGTACAATATCAACAACTCAGTTTCTTTTTCCTCTGCTGTCAAATGTGTGTGCAATCTAATGATAAAGG
AGCCAAAGTCTTCTAGCAGGACTCTCGGCAGAGCTCCATACTCATTTACCTTTAACTCACAGTTTGAATT
TGGAAAGAAACACAAATGGATTCAGATTGATGTGACCAGCCTCCTTCAACCTTTAGTGGCCTCCAACAAG
AGAAGTATTCACATGTCTATAAATTTTACTTGCATGAAAGACCAGCTGGAGCATCCTTCAGCACAGAATG
GTTTGTTTAACATGACTCTGGTGTCCCCCTCACTGATCTTATATTTGAATGACACAAGTGCTCAGGCTTA
TCACAGCTGGTATTCCCTTCACTATAAAAGGAGGCCTTCCCAGGGTCCTGACCAGGAGAGAAGTCTGTCT
GCCTATCCTGTGGGAGAAGAGGCTGCTGAGGATGGGAGATCTTCCCATCACCGTCACCGCAGAGGTCAGG
AAACTGTCAGTTCTGAATTGAAGAAGCCCTTGGGCCCAGCTTCCTTCAATCTGAGTGAATACTTCAGACA
ATTTCTTCTTCCCCAAAATGAGTGTGAGCTCCATGACTTTAGACTTAGCTTTAGTCAGCTGAAGTGGGAC
AACTGGATTGTGGCTCCGCACAGGTACAACCCTCGATACTGTAAAGGGGACTGTCCAAGGGCAGTTGGAC
ATCGGTATGGCTCTCCAGTTCACACCATGGTACAGAACATCATCTATGAGAAGCTGGACTCCTCAGTGCC
AAGACCGTCATGTGTACCTGCCAAATACAGCCCCTTGAGTGTTTTGACCATTGAGCCCGATGGCTCAATT
GCCTATAAAGAGTACGAAGATATGATAGCTACAAAGTGCACCTGTCGTTAA


Restriction Sites SgfI-MluI     
ACCN NM_001288826
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001288826.2, NP_001275755.1
RefSeq Size 1808 bp
RefSeq ORF 1101 bp
Locus ID 2661
Cytogenetics 5q31.1
Protein Families Adult stem cells, Cancer stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Secreted Protein, Stem cell - Pluripotency, Stem cell relevant signaling - TGFb/BMP signaling pathway, Transmembrane
Gene Summary 'This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates ovarian function. Reduced expression of this gene may be associated with polycystic ovary syndrome and mutations in this gene may be more common in mothers of dizygotic twins. [provided by RefSeq, Jul 2016]'
Transcript Variant: This variant (4) contains two alternate exons in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus than isoform 1. Variants 2, 3, 4, 5, and 6 encode the same isoform (2).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.