Ikaros (IKZF1) (NM_001291841) Human Untagged Clone

CAT#: SC335733

IKZF1 (untagged) - Human IKAROS family zinc finger 1 (Ikaros) (IKZF1), transcript variant Ik-7


  "NM_001291841" in other vectors (1)

Reconstitution Protocol

USD 380.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "IKZF1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol IKZF1
Synonyms CVID13; Hs.54452; IK1; IKAROS; LyF-1; LYF1; PPP1R92; PRO0758; ZNFN1A1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001291841, the custom clone sequence may differ by one or more nucleotides


ATGGATGCTGATGAGGGTCAAGACATGTCCCAAGTTTCAGGGAAGGAAAGCCCCCCTGTAAGCGATACTC
CAGATGAGGGCGATGAGCCCATGCCGATCCCCGAGGACCTCTCCACCACCTCGGGAGGACAGCAAAGCTC
CAAGAGTGACAGAGTCGTGGTTGGTAAACCTCACAAATGTGGATATTGTGGCCGAAGCTATAAACAGCGA
AGCTCTTTAGAGGAACATAAAGAGCGCTGCCACAACTACTTGGAAAGCATGGGCCTTCCGGGCACACTGT
ACCCAGTCATTAAAGAAGAAACTAATCACAGTGAAATGGCAGAAGACCTGTGCAAGATAGGATCAGAGAG
ATCTCTCGTGCTGGACAGACTAGCAAGTAACGTCGCCAAACGTAAGAGCTCTATGCCTCAGAAATTTCTT
GGGGACAAGGGCCTGTCCGACACGCCCTACGACAGCAGCGCCAGCTACGAGAAGGAGAACGAAATGATGA
AGTCCCACGTGATGGACCAAGCCATCAACAACGCCATCAACTACCTGGGGGCCGAGTCCCTGCGCCCGCT
GGTGCAGACGCCCCCGGGCGGTTCCGAGGTGGTCCCGGTCATCAGCCCGATGTACCAGCTGCACAAGCCG
CTCGCGGAGGGCACCCCGCGCTCCAACCACTCGGCCCAGGACAGCGCCGTGGAGAACCTGCTGCTGCTCT
CCAAGGCCAAGTTGGTGCCCTCGGAGCGCGAGGCGTCCCCGAGCAACAGCTGCCAAGACTCCACGGACAC
CGAGAGCAACAACGAGGAGCAGCGCAGCGGTCTCATCTACCTGACCAACCACATCGCCCCGCACGCGCGC
AACGGGCTGTCGCTCAAGGAGGAGCACCGCGCCTACGACCTGCTGCGCGCCGCCTCCGAGAACTCGCAGG
ACGCGCTCCGCGTGGTCAGCACCAGCGGGGAGCAGATGAAGGTGTACAAGTGCGAACACTGCCGGGTGCT
CTTCCTGGATCACGTCATGTACACCATCCACATGGGCTGCCACGGCTTCCGTGATCCTTTTGAGTGCAAC
ATGTGCGGCTACCACAGCCAGGACCGGTACGAGTTCTCGTCGCACATAACGCGAGGGGAGCACCGCTTCC
ACATGAGCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001291841
ORF Size 1131 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001291841.1, NP_001278770.1
RefSeq Size 5634
RefSeq ORF 1131
Locus ID 10320
Protein Families Druggable Genome, Transcription Factors
Gene Summary This gene encodes a transcription factor that belongs to the family of zinc-finger DNA-binding proteins associated with chromatin remodeling. The expression of this protein is restricted to the fetal and adult hemo-lymphopoietic system, and it functions as a regulator of lymphocyte differentiation. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. Most isoforms share a common C-terminal domain, which contains two zinc finger motifs that are required for hetero- or homo-dimerization, and for interactions with other proteins. The isoforms, however, differ in the number of N-terminal zinc finger motifs that bind DNA and in nuclear localization signal presence, resulting in members with and without DNA-binding properties. Only a few isoforms contain the requisite three or more N-terminal zinc motifs that confer high affinity binding to a specific core DNA sequence element in the promoters of target genes. The non-DNA-binding isoforms are largely found in the cytoplasm, and are thought to function as dominant-negative factors. Overexpression of some dominant-negative isoforms have been associated with B-cell malignancies, such as acute lymphoblastic leukemia (ALL). [provided by RefSeq, May 2014]
Transcript Variant: This variant (Ik-7) lacks two consecutive in-frame exons in the central coding region, compared to variant 1. The encoded isoform (Ik-7) is shorter than isoform 1. This isoform contains only one N-terminal zinc finger motif, and represents a non-DNA-binding, dominant-negative isoform (PMID:9892693). Sequence Note: The 5' UTR of this variant is incomplete because there are no full-length transcripts supporting this variant, and there is splicing ambiguity in the 5' UTR.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.