ALDH6A1 (NM_001278594) Human Untagged Clone

CAT#: SC335759

ALDH6A1 (untagged) - Human aldehyde dehydrogenase 6 family, member A1 (ALDH6A1), transcript variant 3


  "NM_001278594" in other vectors (1)

Reconstitution Protocol

USD 380.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "ALDH6A1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ALDH6A1
Synonyms MMSADHA; MMSDH
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001278594, the custom clone sequence may differ by one or more nucleotides


ATGATGGGAGAGACCATGCCATCCATCACCAAAGACATGGACCTTTATTCCTACCGTCTGCCTCTGGGAG
TGTGTGCAGGCATTGCTCCATTCAATTTTCCTGCCATGATCCCCCTTTGGATGTTTCCCATGGCCATGGT
GTGTGGAAATACCTTCCTAATGAAACCATCTGAGCGAGTCCCTGGAGCAACTATGCTTCTTGCTAAGTTG
CTCCAGGATTCTGGTGCCCCTGATGGAACATTAAACATCATCCATGGACAGCATGAAGCTGTAAATTTTA
TTTGCGATCATCCGGACATCAAAGCAATCAGCTTTGTGGGATCCAACAAGGCAGGAGAGTATATCTTCGA
GAGAGGATCAAGACATGGCAAGAGGGTTCAAGCCAATATGGGAGCCAAGAACCATGGGGTAGTCATGCCA
GATGCCAATAAGGAAAATACCCTGAACCAGCTGGTTGGGGCAGCATTTGGAGCTGCTGGTCAGCGCTGCA
TGGCTCTTTCAACAGCAGTCCTTGTGGGAGAAGCCAAGAAGTGGCTGCCAGAGCTGGTGGAGCATGCCAA
AAACCTGAGAGTCAATGCAGGAGATCAGCCTGGAGCTGATCTTGGCCCTCTGATCACTCCCCAGGCCAAA
GAGCGAGTCTGTAATCTGATTGATAGTGGAACAAAGGAGGGAGCTTCCATCCTTCTTGATGGACGAAAAA
TTAAAGTGAAAGGCTATGAAAATGGCAACTTTGTTGGACCAACCATCATCTCGAATGTCAAGCCAAATAT
GACCTGTTACAAAGAGGAGATTTTTGGTCCAGTTCTTGTGGTTCTGGAGACAGAAACATTGGATGAAGCC
ATCCAGATTGTAAATAACAACCCATATGGAAATGGAACTGCCATCTTCACCACCAATGGAGCCACTGCTC
GGAAATATGCCCACTTGGTGGATGTTGGACAGGTGGGAGTGAATGTCCCCATTCCAGTGCCTTTGCCAAT
GTTCTCATTCACCGGCTCTCGATCCTCCTTCAGGGGAGACACCAATTTCTATGGCAAACAGGGCATCCAA
TTCTACACTCAGTTAAAGACCATTACTTCTCAGTGGAAAGAAGAAGATGCTACTCTTTCCTCACCTGCTG
TTGTCATGCCTACCATGGGCCGTTAG


Restriction Sites SgfI-MluI     
ACCN NM_001278594
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278594.1, NP_001265523.1
RefSeq Size 4864 bp
RefSeq ORF 1146 bp
Locus ID 4329
Cytogenetics 14q24.3
Protein Families Druggable Genome, Transmembrane
Protein Pathways Inositol phosphate metabolism, Metabolic pathways, Propanoate metabolism, Valine, leucine and isoleucine degradation
Gene Summary 'This gene encodes a member of the aldehyde dehydrogenase protein family. The encoded protein is a mitochondrial methylmalonate semialdehyde dehydrogenase that plays a role in the valine and pyrimidine catabolic pathways. This protein catalyzes the irreversible oxidative decarboxylation of malonate and methylmalonate semialdehydes to acetyl- and propionyl-CoA. Methylmalonate semialdehyde dehydrogenase deficiency is characterized by elevated beta-alanine, 3-hydroxypropionic acid, and both isomers of 3-amino and 3-hydroxyisobutyric acids in urine organic acids. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]'
Transcript Variant: This variant (3) uses an alternate in-frame splice site in the 3' coding region and uses a downstream start codon compared to variant 1, compared to variant 1. The encoded protein (isoform 3) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.