Dematin (DMTN) (NM_001302816) Human Untagged Clone

CAT#: SC335772

DMTN (untagged) - Human dematin actin binding protein (DMTN), transcript variant 7

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DMTN
• Synonyms: DMT; EPB49
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001302816, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAACGGCTGCAGAAGCAACCACTTACCTCCCCCGGGAGCGTGAGCCCCTCCCGAGATTCCAGTGTGC
  CTGGCTCTCCCTCCAGCATCGTGGCCAAGATGGACAATCAGGTGCTGGGCTACAAGGACCTGGCTGCCAT
  CCCCAAGGACAAGGCCATCCTGGACATCGAGCGGCCCGACCTCATGATCTACGAGCCTCACTTCACTTAT
  TCCCTCCTGGAACACGTGGAGCTGCCTCGCAGCCGCGAGCGCTCGCTGTCACCCAAATCCACATCCCCCC
  CACCATCCCCAGAGGTGTGGGCGGACAGCCGGTCGCCTGGAATCATCTCTCAGGCCTCGGCCCCCAGAAC
  CACTGGAACCCCCCGGACCAGCCTGCCCCATTTCCACCACCCTGAGACCTCCCGCCCAGATTCCAACATC
  TACAAGAAGCCTCCCATCTATAAGCAGAGAGAGTCCGTGGGAGGCAGCCCTCAGACCAAGCACCTCATCG
  AGGATCTCATCATCGAGTCATCCAAGTTTCCTGCAGCCCAGCCCCCAGACCCCAACCAGCCAGCCAAAAT
  CGAAACCGACTACTGGCCATGCCCCCCGTCTCTGGCTGTTGTGGAGACAGAATGGAGGAAGCGGAAGGCG
  TCTCGGAGGGGAGCAGAGGAAGAGGAGGAGGAGGAAGATGACGACTCTGGAGAGGAGATGAAGGCTCTCA
  GGGAGCGTCAGAGAGAGGAACTCAGTAAGGTTACTTCCAACTTGGGAAAGATGATCTTGAAAGAAGAGAT
  GGAAAAGTCATTGCCGATCCGAAGGAAAACCCGCTCTCTGCCTGACCGGACACCCTTCCATACCTCCTTG
  CACCAGGGAACGTCTAAATCTTCCTCTCTCCCCGCCTATGGCAGGACCACCCTGAGCCGGCTACAGTCCA
  CAGAGTTCAGCCCATCAGGGAGTGAGACTGGAAGCCCAGGCCTGCAGATCTATCCCTATGAAATGCTAGT
  GGTGACCAACAAGGGGCGAACCAAGCTGCCACCGGGGGTGGATCGGATGCGGCTTGAGAGGCATCTGTCT
  GCCGAGGACTTCTCAAGGGTATTTGCCATGTCCCCTGAAGAGTTTGGCAAGCTGGCTCTGTGGAAGCGGA
  ATGAGCTCAAGAAGAAGGCCTCTCTCTTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001302816
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001302816.1, NP_001289745.1
• RefSeq Size: 2754 bp
• RefSeq ORF: 1152 bp
• Locus ID: 2039
• Cytogenetics: 8p21.3
• Gene Summary: 'The protein encoded by this gene is an actin binding and bundling protein that plays a structural role in erythrocytes, by stabilizing and attaching the spectrin/actin cytoskeleton to the erythrocyte membrane in a phosphorylation-dependent manner. This protein contains a core domain in the N-terminus, and a headpiece domain in the C-terminus that binds F-actin. When purified from erythrocytes, this protein exists as a trimer composed of two 48 kDa polypeptides and a 52 kDa polypeptide. The different subunits arise from alternative splicing in the 3' coding region, where the headpiece domain is located. Disruption of this gene has been correlated with the autosomal dominant Marie Unna hereditary hypotrichosis disease, while loss of heterozygosity of this gene is thought to play a role in prostate cancer progression. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2014]'
  Transcript Variant: This variant (7) lacks an alternate in-frame exon in the 3' coding region, compared to variant 1. Variants 4, 5 and 7 encode the same isoform (2, also known as the 48 kDa subunit, PMID:7615546), which is shorter than isoform 1.