CDC25B (NM_001287524) Human Untagged Clone

CAT#: SC335798

CDC25B (untagged) - Human cell division cycle 25B (CDC25B), transcript variant 10

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CDC25B
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001287524, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCGGATGGATTTGTCTTCAAGATGCCATGGAAGCCCACACATCCCAGCTCCACCCATGCTCTGGCAG
  AGTGGGCCAGCCGCAGGGAAGCCTTTGCCCAGAGACCCAGCTCGGCCCCCGACCTGATGTGTCTCAGTCC
  TGACCGGAAGATGGAAGTGGAGGAGCTCAGCCCCCTGGCCCTAGGTCGCTTCTCTCTGACCCCTGCAGAG
  GGGGATACTGAGGAAGATGATGGATTTGTGGACATCCTAGAGAGTGACTTAAAGGATGATGATGCAGTTC
  CCCCAGGCATGGAGAGTCTCATTAGTGCCCCACTGGTCAAGACCTTGGAAAAGGAAGAGGAAAAGGACCT
  CGTCATGTACAGCAAGTGCCAGCGGCTCTTCCGCTCTCCGTCCATGCCCTGCAGCGTGATCCGGCCCATC
  CTCAAGAGGCTGGAGCGGCCCCAGGACAGGGACACGCCCGTGCAGAATAAGCGGAGGCGGAGCGTGACCC
  CTCCTGAGGAGCAGCAGGAGGCTGAGGAACCTAAAGCCCGCGTCCTCCGCTCAAAATCACTGTGTCACGA
  TGAGATCGAGAACCTCCTGGACAGTGACCACCGAGAGCTGATTGGAGATTACTCTAAGGCCTTCCTCCTA
  CAGACAGTAGACGGAAAGCACCAAGACCTCAAGTACATCTCACCAGAAACGATGGTGGCCCTATTGACGG
  GCAAGTTCAGCAACATCGTGGATAAGTTTGTGATTGTAGACTGCAGATACCCCTATGAATATGAAGGCGG
  GCACATCAAGACTGCGGTGAACTTGCCCCTGGAACGCGACGCCGAGAGCTTCCTACTGAAGAGCCCCATC
  GCGCCCTGTAGCCTGGACAAGAGAGTCATCCTCATTTTCCACTGTGAATTCTCATCTGAGCGTGGGCCCC
  GCATGTGCCGTTTCATCAGGGAACGAGACCGTGCTGTCAACGACTACCCCAGCCTCTACTACCCTGAGAT
  GTATATCCTGAAAGGCGGCTACAAGGAGTTCTTCCCTCAGCACCCGAACTTCTGTGAACCCCAGGACTAC
  CGGCCCATGAACCACGAGGCCTTCAAGGATGAGCTAAAGACCTTCCGCCTCAAGACTCGCAGCTGGGCTG
  GGGAGCGGAGCCGGCGGGAGCTCTGTAGCCGGCTGCAGGACCAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001287524
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001287524.1, NP_001274453.1
• RefSeq Size: 2626 bp
• RefSeq ORF: 1167 bp
• Locus ID: 994
• Cytogenetics: 20p13
• Protein Families: Druggable Genome, Phosphatase
• Protein Pathways: Cell cycle, MAPK signaling pathway, Progesterone-mediated oocyte maturation
• Gene Summary: 'CDC25B is a member of the CDC25 family of phosphatases. CDC25B activates the cyclin dependent kinase CDC2 by removing two phosphate groups and it is required for entry into mitosis. CDC25B shuttles between the nucleus and the cytoplasm due to nuclear localization and nuclear export signals. The protein is nuclear in the M and G1 phases of the cell cycle and moves to the cytoplasm during S and G2. CDC25B has oncogenic properties, although its role in tumor formation has not been determined. Multiple transcript variants for this gene exist. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (10) differs in the 5' UTR and has multiple coding region differences, compared to variant 1, which causes translation initiation at a downstream start codon. The resulting protein (isoform 9) has a shorter N-terminus and lacks an internal region compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.