HARS (NM_001289093) Human Untagged Clone

CAT#: SC335846

HARS (untagged) - Human histidyl-tRNA synthetase (HARS), transcript variant 6


  "NM_001289093" in other vectors (1)

Reconstitution Protocol

USD 400.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "HARS"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HARS
Synonyms CMT2W; HRS; USH3B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001289093, the custom clone sequence may differ by one or more nucleotides


ATGGCAGAGCGTGCGGCGCTGGAGGAGCTGGTGAAACTTCAGGGAGAGCGCGTGCGAGGCCTCAAGCAGC
AGAAGGCCAGCGCCGAGCTGATCGAGGAGGAGGTGGCGAAACTCCTGAAACTGAAGGCACAGCTGGGTCC
TGATGAAAGCAAACAGAAATTTGTGCTCAAAACCCCCAAGGATTTTGACATTGCTGGGAACTTTGATCCC
ATGATCCCTGATGCAGAGTGCCTGAAGATCATGTGCGAGATCCTGAGTTCACTTCAGATAGGCGACTTCC
TGGTCAAGGTAAACGATCGACGCATTCTAGATGGGATGTTTGCTATCTGTGGTGTTTCTGACAGCAAGTT
CCGTACCATCTGCTCCTCAGTAGACAAGCTGGACAAGGTGTCCTGGGAAGAGGTGAAGAATGAGATGGTG
GGAGAGAAGGGCCTTGCACCTGAGGTGGCTGACCGCATTGGGGACTATGTCCAGCAACATGGTGGGGTAT
CCCTGGTGGAACAGCTGCTCCAGGATCCTAAACTATCCCAAAACAAGCAGGCCTTGGAGGGCCTGGGAGA
CCTGAAGTTGCTCTTTGAGTACCTGACCCTATTTGGCATTGATGACAAAATCTCCTTTGACCTGAGCCTT
GCTCGAGGGCTGGATTACTACACTGGGGTGATCTATGAGGCAGTGCTGCTACAGACCCCAGCCCAGGCAG
GGGAAGAGCCCCTGGGTGTGGGCAGTGTGGCTGCTGGAGGACGCTATGATGGGCTAGTGGGCATGTTCGA
CCCCAAAGGGCGCAAGGTGCCATGTGTGGGGCTCAGCATTGGGGTGGAGCGGATTTTCTCCATCGTGGAA
CAGAGACTAGAGGCTTTGGAGGAGAAGATACGGACCACGGAGACACAGGTGCTTGTGGCATCTGCACAGA
AGAAGCTGCTAGAGGAAAGACTAAAGCTTGTCTCAGAACTGTGGGATGCTGGGATCAAGGCTGAGCTGCT
GTACAAGAAGAACCCAAAGCTACTGAACCAGTTACAGTACTGTGAGGAGGCAGGCATCCCACTGGTGGCT
ATCATCGGCGAGCAGGAACTCAAGGATGGGGTCATCAAGCTCCGTTCAGTGACGAGCAGGGAAGAGGTGG
ATGTCCGAAGAGAAGACCTTGTGGAGGAAATCAAAAGGAGAACAGGCCAGCCCCTCTGCATCTGCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001289093
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001289093.1, NP_001276022.1
RefSeq Size 1964 bp
RefSeq ORF 1188 bp
Locus ID 3035
Cytogenetics 5q31.3
Protein Pathways Aminoacyl-tRNA biosynthesis
Gene Summary 'Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. The protein encoded by this gene is a cytoplasmic enzyme which belongs to the class II family of aminoacyl-tRNA synthetases. The enzyme is responsible for the synthesis of histidyl-transfer RNA, which is essential for the incorporation of histidine into proteins. The gene is located in a head-to-head orientation with HARSL on chromosome five, where the homologous genes share a bidirectional promoter. The gene product is a frequent target of autoantibodies in the human autoimmune disease polymyositis/dermatomyositis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]'
Transcript Variant: This variant (6) lacks three alternate in-frame exons in the 5' coding region, compared to variant 1. The encoded protein (isoform 6) is shorter, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.