Dopamine Receptor D3 (DRD3) (NM_001282563) Human Untagged Clone

CAT#: SC335870

DRD3 (untagged) - Human dopamine receptor D3 (DRD3), transcript variant f


  "NM_001282563" in other vectors (1)

Reconstitution Protocol

USD 400.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "DRD3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DRD3
Synonyms D3DR; ETM1; FET1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001282563, the custom clone sequence may differ by one or more nucleotides


ATGGCATCTCTGAGCCAGCTGAGTGGCCACCTGAACTACACCTGTGGGGCAGAGAACTCCACAGGTGCCA
GCCAGGCCCGCCCACATGCCTACTATGCCCTCTCCTACTGCGCGCTCATCCTGGCCATCGTCTTCGGCAA
TGGCCTGGTGTGCATGGCTGTGCTGAAGGAGCGGGCCCTGCAGACTACCACCAACTACTTAGTAGTGAGC
CTGGCTGTGGCAGACTTGCTGGTGGCCACCTTGGTGATGCCCTGGGTGGTATACCTGGAGGTGACAGGTG
GAGTCTGGAATTTCAGCCGCATTTGCTGTGATGTTTTTGTCACCCTGGATGTCATGATGTGTACAGCCAG
CATCCTTAATCTCTGTGCCATCAGCATAGACAGGTACACTGCAGTGGTCATGCCCGTTCACTACCAGCAT
GGCACGGGACAGAGCTCCTGTCGGCGCGTGGCCCTCATGATCACGGCCGTCTGGGTACTGGCCTTTGCTG
TGTCCTGCCCTCTTCTGTTTGGCTTTAATACCACAGGGGACCCCACTGTCTGCTCCATCTCCAACCCTGA
TTTTGTCATCTACTCTTCAGTGGTGTCCTTCTACCTGCCCTTTGGAGTGACTGTCCTTGTCTATGCCAGA
ATCTATGTGGTGCTGAAACAAAGGAGACGGAAAAGGATCCTCACTCGACAGAACAGTCAGTGCAACAGTG
TCAGGCCTGGCTTCCCCCAACAAACCCTCTCTCCTGACCCGGCACATCTGGAGCTGAAGCGTTACTACAG
CATCTGCCAGGACACTGCCTTGGGTGGACCAGGCTTCCAAGAAAGAGGAGGAGAGTTGAAAAGAGAGGAG
AAGACTCGGAATTCCCTGAGTCCCACCATAGCGCCCAAGCTCAGCTTAGAAGTTCGAAAACTCAGCAATG
GCAGATTATCGACATCTTTGAAGCTGGGGCCCCTGCAACCTCGGGGAGTGCCACTTCGGGAGAAGAAGGC
AACCCAAATGGTGGCCATTGTGCTTGGGGCCTTCATTGTCTGCTGGCTGCCCTTCTTCTTGACCCATGTT
CTCAATACCCACTGCCAGACATGCCACGTGTCCCCAGAGCTTTACAGTGCCACGACATGGCTGGGCTACG
TGAATAGCGCCCTCAACCCTGTGATCTATACCACCTTCAATATCGAGTTCCGGAAAGCCTTCCTCAAGAT
CCTGTCTTGCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001282563
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282563.2, NP_001269492.1
RefSeq Size 1557 bp
RefSeq ORF 1203 bp
Locus ID 1814
Cytogenetics 3q13.31
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
Gene Summary 'This gene encodes the D3 subtype of the five (D1-D5) dopamine receptors. The activity of the D3 subtype receptor is mediated by G proteins which inhibit adenylyl cyclase. This receptor is localized to the limbic areas of the brain, which are associated with cognitive, emotional, and endocrine functions. Genetic variation in this gene may be associated with susceptibility to hereditary essential tremor 1. Alternative splicing of this gene results in transcript variants encoding different isoforms, although some variants may be subject to nonsense-mediated decay (NMD). [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (f) differs in the 5' UTR compared to variant a. Variants a, f and g encode the same isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.