PLAGL1 (NM_001289040) Human Untagged Clone

CAT#: SC335950

PLAGL1 (untagged) - Human pleiomorphic adenoma gene-like 1 (PLAGL1), transcript variant 14


  "NM_001289040" in other vectors (1)

Reconstitution Protocol

USD 410.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "PLAGL1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PLAGL1
Synonyms LOT1; ZAC; ZAC1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001289040, the custom clone sequence may differ by one or more nucleotides


ATGGCTACCCATTCTCCCCAGAAATCTCACCAGTGTGCTCACTGTGAGAAGACGTTCAACCGGAAAGACC
ACCTGAAAAACCACCTCCAGACCCACGACCCCAACAAAATGGCCTTTGGGTGTGAGGAGTGTGGGAAGAA
GTACAACACCATGCTGGGCTATAAGAGGCACCTGGCCCTCCATGCGGCCAGCAGTGGGGACCTCACCTGT
GGGGTCTGTGCCCTGGAGCTAGGGAGCACCGAGGTGCTACTGGACCACCTCAAAGCCCATGCGGAAGAGA
AGCCCCCTAGCGGAACCAAGGAAAAGAAGCACCAGTGCGACCACTGTGAAAGATGCTTCTACACCCGGAA
GGATGTGCGACGCCACCTGGTGGTCCACACAGGATGCAAGGACTTCCTGTGCCAGTTCTGTGCCCAGAGA
TTTGGGCGCAAGGATCACCTCACCCGGCATACCAAGAAGACCCACTCACAGGAGCTGATGAAAGAGAGCT
TGCAGACCGGAGACCTTCTGAGCACCTTCCACACCATCTCGCCTTCATTCCAACTGAAGGCTGCTGCCTT
GCCTCCTTTCCCTTTAGGAGCTTCTGCCCAGAACGGGCTTGCAAGTAGCTTGCCAGCTGAGGTCCATAGC
CTCACCCTCAGTCCCCCAGAACAAGCCGCCCAGCCTATGCAGCCGCTGCCAGAGTCCCTGGCCTCCCTCC
ACCCCTCGGTATCCCCTGGCTCTCCTCCGCCACCCCTTCCCAATCACAAGTACAACACCACTTCTACCTC
ATACTCCCCACTTGCAAGCCTGCCCCTCAAAGCAGATACTAAAGGTTTTTGCAATATCAGTTTGTTTGAG
GACTTGCCTCTGCAAGAGCCTCAGTCACCTCAAAAGCTCAACCCAGGTTTTGATCTGGCTAAGGGAAATG
CTGGTAAAGTAAACCTGCCCAAGGAGCTGCCTGCAGATGCTGTGAACCTAACAATACCTGCCTCTCTGGA
CCTGTCCCCCCTGTTGGGCTTCTGGCAGCTGCCCCCTCCTGCTACCCAAAATACCTTTGGGAATAGCACT
CTTGCCCTGGGGCCTGGGGAATCTTTGCCCCACAGGTTAAGCTGTCTGGGGCAGCAGCAGCAAGAACCCC
CACTTGCCATGGGCACTGTGAGCCTGGGCCAGCTCCCCCTGCCCCCCATCCCTCATGTGTTCTCAGCTGG
CACTGGCTCTGCCATCCTGCCTCATTTCCATCATGCATTCAGATAA


Restriction Sites SgfI-MluI     
ACCN NM_001289040
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001289040.1, NP_001275969.1
RefSeq Size 2729 bp
RefSeq ORF 1236 bp
Locus ID 5325
Cytogenetics 6q24.2
Protein Families Transcription Factors
Gene Summary 'This gene encodes a C2H2 zinc finger protein that functions as a suppressor of cell growth. This gene is often deleted or methylated and silenced in cancer cells. In addition, overexpression of this gene during fetal development is thought to be the causal factor for transient neonatal diabetes mellitus (TNDM). Alternative splicing and the use of alternative promoters results in multiple transcript variants encoding two different protein isoforms. The P1 downstream promoter of this gene is imprinted, with preferential expression from the paternal allele in many tissues. [provided by RefSeq, Nov 2015]'
Transcript Variant: This variant (14, also known as P2I) initiates from the P2 promoter, differs in the 5' UTR and 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (1, also known as ZACdelta2) has a shorter N-terminus than isoform 2. Variants 7, 8, 9, 11, 13, 14, 21, 24, and 26 all encode the same isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.