RFX3 (NM_001282117) Human Untagged Clone

CAT#: SC335970

RFX3 (untagged) - Human regulatory factor X, 3 (influences HLA class II expression) (RFX3), transcript variant 4


  "NM_001282117" in other vectors (1)

Reconstitution Protocol

USD 410.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "RFX3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RFX3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001282117, the custom clone sequence may differ by one or more nucleotides


ATGCAGACATCAGAGACTGGGTCGGACACAGGCTCGACAGTGACCTTACAAACATCTGTGGCTAGTCAAG
CAGCAGTGCCTACGCAGGTGGTACAGCAAGTACCAGTACAACAACAGGTACAGCAGGTACAGACTGTGCA
GCAGGTACAACATGTCTATCCCGCTCAGGTGCAGTATGTGGAAGGAAGCGATACTGTCTATACCAATGGA
GCAATCCGAACAACAACGTATCCTTACACAGAGACACAGATGTACAGCCAAAATACTGGAGGGAATTACT
TTGATACTCAAGGGAGTTCCGCCCAGGTGACTACCGTGGTCTCATCCCACAGTATGGTGGGCACTGGTGG
GATTCAGATGGGCGTCACAGGAGGACAACTCATCAGCAGCTCTGGAGGAACCTATCTGATCGGCAACTCA
ATGGAGAATTCTGGTCACTCAGTGACACACACAACTCGGGCCTCCCCAGCGACAATTGAAATGGCGATTG
AGACGCTGCAAAAGTCTGACGGTCTGTCCACTCACAGAAGCTCTCTTCTCAACAGCCATCTCCAGTGGCT
GTTGGACAATTATGAGACAGCAGAAGGAGTGAGCCTTCCCAGAAGCACTCTGTACAACCACTACCTTCGA
CACTGTCAGGAACACAAACTGGACCCAGTCAATGCTGCCTCTTTTGGAAAATTAATAAGATCAATTTTTA
TGGGGCTACGAACCAGGAGATTGGGCACTAGAGGAAACTCCAAATACCACTACTATGGGATTCGTGTCAA
GCCAGATTCCCCTCTTAATCGTCTGCAAGAAGACATGCAGTATATGGCTATGAGACAACAACCCATGCAA
CAGAAACAAAGGTACAAGCCTATGCAGAAAGTGGATGGGGTTGCAGATGGTTTCACAGGAAGTGGTCAAC
AGACAGGCACATCTGTTGAGCAAACTGTAATTGCCCAAAGCCAACATCATCAACAGTTTTTAGATGCATC
TCGAGCACTTCCAGAGTTTGGAGAAGTTGAAATCTCTTCTCTGCCAGATGGTACTACCTTTGAGGATATC
AAGTCACTGCAGAGTCTTTATAGAGAGCACTGTGAGGCAATATTGGACGTTGTTGTGAATCTTCAATTTA
GCCTGATAGAAAAATTGTGGCAAACATTCTGGCGCTATTCTCCCTCTACTCCAACTGATGGCACTACCAT
TACCGAATCGAGGTCAGAATCAACATCTTTTCCAATTCATTTTCATGGCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001282117
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282117.1, NP_001269046.1
RefSeq Size 1543 bp
RefSeq ORF 1242 bp
Locus ID 5991
Cytogenetics 9p24.2
Protein Families Transcription Factors
Gene Summary 'This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X2, X4, and X5. It is a transcriptional activator that can bind DNA as a monomer or as a heterodimer with other RFX family members. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2013]'
Transcript Variant: This variant (4) differs in the 5' UTR and its 3' terminal exon extends past a splice site that is used in variant 2. This results in a novel 3' coding region and 3' UTR, compared to variant 2. It encodes isoform c which is shorter and has a distinct C-terminus, compared to isoform b.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.