RFX3 (NM_001282117) Human Untagged Clone
CAT#: SC335970
RFX3 (untagged) - Human regulatory factor X, 3 (influences HLA class II expression) (RFX3), transcript variant 4
"NM_001282117" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RFX3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001282117, the custom clone sequence may differ by one or more nucleotides
ATGCAGACATCAGAGACTGGGTCGGACACAGGCTCGACAGTGACCTTACAAACATCTGTGGCTAGTCAAG CAGCAGTGCCTACGCAGGTGGTACAGCAAGTACCAGTACAACAACAGGTACAGCAGGTACAGACTGTGCA GCAGGTACAACATGTCTATCCCGCTCAGGTGCAGTATGTGGAAGGAAGCGATACTGTCTATACCAATGGA GCAATCCGAACAACAACGTATCCTTACACAGAGACACAGATGTACAGCCAAAATACTGGAGGGAATTACT TTGATACTCAAGGGAGTTCCGCCCAGGTGACTACCGTGGTCTCATCCCACAGTATGGTGGGCACTGGTGG GATTCAGATGGGCGTCACAGGAGGACAACTCATCAGCAGCTCTGGAGGAACCTATCTGATCGGCAACTCA ATGGAGAATTCTGGTCACTCAGTGACACACACAACTCGGGCCTCCCCAGCGACAATTGAAATGGCGATTG AGACGCTGCAAAAGTCTGACGGTCTGTCCACTCACAGAAGCTCTCTTCTCAACAGCCATCTCCAGTGGCT GTTGGACAATTATGAGACAGCAGAAGGAGTGAGCCTTCCCAGAAGCACTCTGTACAACCACTACCTTCGA CACTGTCAGGAACACAAACTGGACCCAGTCAATGCTGCCTCTTTTGGAAAATTAATAAGATCAATTTTTA TGGGGCTACGAACCAGGAGATTGGGCACTAGAGGAAACTCCAAATACCACTACTATGGGATTCGTGTCAA GCCAGATTCCCCTCTTAATCGTCTGCAAGAAGACATGCAGTATATGGCTATGAGACAACAACCCATGCAA CAGAAACAAAGGTACAAGCCTATGCAGAAAGTGGATGGGGTTGCAGATGGTTTCACAGGAAGTGGTCAAC AGACAGGCACATCTGTTGAGCAAACTGTAATTGCCCAAAGCCAACATCATCAACAGTTTTTAGATGCATC TCGAGCACTTCCAGAGTTTGGAGAAGTTGAAATCTCTTCTCTGCCAGATGGTACTACCTTTGAGGATATC AAGTCACTGCAGAGTCTTTATAGAGAGCACTGTGAGGCAATATTGGACGTTGTTGTGAATCTTCAATTTA GCCTGATAGAAAAATTGTGGCAAACATTCTGGCGCTATTCTCCCTCTACTCCAACTGATGGCACTACCAT TACCGAATCGAGGTCAGAATCAACATCTTTTCCAATTCATTTTCATGGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282117 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001282117.1, NP_001269046.1 |
RefSeq Size | 1543 bp |
RefSeq ORF | 1242 bp |
Locus ID | 5991 |
Cytogenetics | 9p24.2 |
Protein Families | Transcription Factors |
Gene Summary | 'This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X2, X4, and X5. It is a transcriptional activator that can bind DNA as a monomer or as a heterodimer with other RFX family members. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2013]' Transcript Variant: This variant (4) differs in the 5' UTR and its 3' terminal exon extends past a splice site that is used in variant 2. This results in a novel 3' coding region and 3' UTR, compared to variant 2. It encodes isoform c which is shorter and has a distinct C-terminus, compared to isoform b. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC238076 | RFX3 (myc-DDK-tagged) - Human regulatory factor X, 3 (influences HLA class II expression) (RFX3), transcript variant 4 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review