ACAT2 (NM_001303253) Human Untagged Clone

CAT#: SC336048

ACAT2 (untagged) - Human acetyl-CoA acetyltransferase 2 (ACAT2), transcript variant 2


  "NM_001303253" in other vectors (1)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "ACAT2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ACAT2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001303253, the custom clone sequence may differ by one or more nucleotides


ATGGGGTCGCATCCAGTCCTTCGGATTTGGGGAAATAGAAGGGCTACAGCGGCGTCCCTAGGCCGTTCTG
GAGGTCGCCTGTCCAGCCCTCGGCTGCTGCGAGTTGTGGCACCCACCTTGACCTTTGCTCAGACCAGCAG
GTGTTCCTTCAATGGTGCCTTAGCTGCTGTTCCTGTCCAGGACCTGGGCTCCACTGTCATCAAAGAAGTC
TTGAAGAGGGCCACTGTGGCTCCGGAAGATGTGTCTGAGGTCATCTTTGGACATGTCTTGGCAGCAGGCT
GTGGGCAGAATCCTGTTAGACAAGCCAGTGTGGGTGCAGGAATTCCCTACTCTGTTCCAGCATGGAGCTG
CCAGATGATCTGTGGGTCAGGCCTAAAAGCTGTGTGCCTTGCAGTCCAGTCAATAGGGATAGGAGACTCC
AGCATTGTGGTTGCAGGAGGCATGGAAAATATGAGCAAGGCTCCTCACTTGGCTTACTTGAGAACAGGAG
TAAAGATAGGTGAGATGCCACTGACTGACAGTATACTCTGTGATGGTCTTACAGATGCATTTCACAACTG
TCATATGGGTATTACAGCTGAAAATGTAGCCAAAAAATGGCAAGTGAGTAGAGAAGATCAGGACAAGGTT
GCAGTTCTGTCCCAGAACAGGACAGAGAATGCACAGAAAGCTGGCCATTTTGACAAAGAGATTGTACCAG
TTTTGGTGTCAACTAGAAAAGGTCTTATTGAAGTTAAAACAGATGAGTTTCCTCGCCATGGGAGCAACAT
AGAAGCCATGTCCAAGCTAAAGCCTTACTTTCTTACTGATGGAACGGGAACAGTCACCCCAGCCAATGCT
TCAGGAATAAATGATGGTGCTGCAGCTGTCGTTCTTATGAAGAAGTCAGAAGCTGATAAACGTGGGCTTA
CACCTTTAGCACGGATAGTTTCCTGGTCCCAAGTGGGTGTGGAGCCTTCCATTATGGGAATAGGACCAAT
TCCAGCCATAAAGCAAGCTGTTACAAAAGCAGGTTGGTCACTGGAAGATGTTGACATATTTGAAATCAAT
GAAGCCTTTGCAGCTGTCTCTGCTGCAATAGTTAAAGAACTTGGATTAAACCCAGAGAAGGTCAATATTG
AAGGAGGGGCTATAGCCTTGGGCCACCCTCTTGGAGCATCTGGCTGTCGAATTCTTGTGACCCTGTTACA
CACACTGGAGAGAATGGGCAGAAGTCGTGGTGTTGCAGCCCTGTGCATTGGGGGTGGGATGGGAATAGCA
ATGTGTGTTCAGAGAGAATGA


Restriction Sites SgfI-MluI     
ACCN NM_001303253
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001303253.1, NP_001290182.1
RefSeq Size 1723 bp
RefSeq ORF 1281 bp
Locus ID 39
Cytogenetics 6q25.3
Protein Families Druggable Genome
Protein Pathways Butanoate metabolism, Fatty acid metabolism, Lysine degradation, Metabolic pathways, Propanoate metabolism, Pyruvate metabolism, Synthesis and degradation of ketone bodies, Terpenoid backbone biosynthesis, Tryptophan metabolism, Valine, leucine and isoleucine degradation
Gene Summary 'The product of this gene is an enzyme involved in lipid metabolism, and it encodes cytosolic acetoacetyl-CoA thiolase. This gene shows complementary overlapping with the 3-prime region of the TCP1 gene in both mouse and human. These genes are encoded on opposite strands of DNA, as well as in opposite transcriptional orientation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2014]'
Transcript Variant: This variant (2) differs in the 5' UTR and has an alternate 5' coding region, compared to variant 1. The resulting isoform (2) is longer and has a distinct N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.