CDC25B (NM_001287522) Human Untagged Clone
CAT#: SC336054
CDC25B (untagged) - Human cell division cycle 25B (CDC25B), transcript variant 9
"NM_001287522" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CDC25B |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001287522, the custom clone sequence may differ by one or more nucleotides
ATGGATTCCCCCAGCCCTATGGACCCCCACATGGCGGAGCAGACGTTTGAACAGGCCATCCAGGCAGCCA GCCGGATCATTCGAAACGAGCAGTTTGCCATCAGACGCTTCCAGTCTATGCCGGATGGATTTGTCTTCAA GATGCCATGGAAGCCCACACATCCCAGCTCCACCCATGCTCTGGCAGAGTGGGCCAGCCGCAGGGAAGCC TTTGCCCAGAGACCCAGCTCGGCCCCCGACCTGATGTGTCTCAGTCCTGACCGGAAGATGGAAGTGGAGG AGCTCAGCCCCCTGGCCCTAGGTCGCTTCTCTCTGACCCCTGCAGAGGGGGATACTGAGGAAGATGATGG ATTTGTGGACATCCTAGAGAGTGACTTAAAGGATGATGATGCAGTTCCCCCAGGCATGGAGAGTCTCATT AGTGCCCCACTGGTCAAGACCTTGGAAAAGGAAGAGGAAAAGGACCTCGTCATGTACAGCAAGTGCCAGC GGCTCTTCCGCTCTCCGTCCATGCCCTGCAGCGTGATCCGGCCCATCCTCAAGAGGCTGGAGCGGCCCCA GGACAGGGACACGCCCGTGCAGAATAAGCGGAGGCGGAGCGTGACCCCTCCTGAGGAGCAGCAGGAGGCT GAGGAACCTAAAGCCCGCGTCCTCCGCTCAAAATCACTGTGTCACGATGAGATCGAGAACCTCCTGGACA GTGACCACCGAGAGCTGATTGGAGATTACTCTAAGGCCTTCCTCCTACAGACAGTAGACGGAAAGCACCA AGACCTCAAGTACATCTCACCAGAAACGATGGTGGCCCTATTGACGGGCAAGTTCAGCAACATCGTGGAT AAGTTTGTGATTGTAGACTGCAGATACCCCTATGAATATGAAGGCGGGCACATCAAGACTGCGGTGAACT TGCCCCTGGAACGCGACGCCGAGAGCTTCCTACTGAAGAGCCCCATCGCGCCCTGTAGCCTGGACAAGAG AGTCATCCTCATTTTCCACTGTGAATTCTCATCTGAGCGTGGGCCCCGCATGTGCCGTTTCATCAGGGAA CGAGACCGTGCTGTCAACGACTACCCCAGCCTCTACTACCCTGAGATGTATATCCTGAAAGGCGGCTACA AGGAGTTCTTCCCTCAGCACCCGAACTTCTGTGAACCCCAGGACTACCGGCCCATGAACCACGAGGCCTT CAAGGATGAGCTAAAGACCTTCCGCCTCAAGACTCGCAGCTGGGCTGGGGAGCGGAGCCGGCGGGAGCTC TGTAGCCGGCTGCAGGACCAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001287522 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001287522.1, NP_001274451.1 |
RefSeq Size | 2721 bp |
RefSeq ORF | 1284 bp |
Locus ID | 994 |
Cytogenetics | 20p13 |
Protein Families | Druggable Genome, Phosphatase |
Protein Pathways | Cell cycle, MAPK signaling pathway, Progesterone-mediated oocyte maturation |
Gene Summary | 'CDC25B is a member of the CDC25 family of phosphatases. CDC25B activates the cyclin dependent kinase CDC2 by removing two phosphate groups and it is required for entry into mitosis. CDC25B shuttles between the nucleus and the cytoplasm due to nuclear localization and nuclear export signals. The protein is nuclear in the M and G1 phases of the cell cycle and moves to the cytoplasm during S and G2. CDC25B has oncogenic properties, although its role in tumor formation has not been determined. Multiple transcript variants for this gene exist. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (9) uses an alternate splice site in the 5' UTR which results in initiation of translation at a downstream start codon, compared to variant 1. The encoded protein (isoform 8) has a shorter N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC238160 | CDC25B (myc-DDK-tagged) - Human cell division cycle 25B (CDC25B), transcript variant 9 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review