LILRB1 (NM_001278399) Human Untagged Clone

CAT#: SC336227

LILRB1 (untagged) - Human leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1 (LILRB1), transcript variant 6

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: LILRB1
• Synonyms: CD85J; ILT-2; ILT2; LIR-1; LIR1; MIR-7; MIR7; PIR-B; PIRB
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001278399, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGACCCCCATCCTCACGGTCCTGATCTGTCTCGGGCTGAGTCTGGGCCCCCGGACCCACGTGCAGGCAG
  GGCACCTCCCCAAGCCCACCCTCTGGGCTGAACCAGGCTCTGTGATCACCCAGGGGAGTCCTGTGACCCT
  CAGGTGTCAGGGGGGCCAGGAGACCCAGGAGTACCGTCTATATAGAGAAAAGAAAACAGCACCCTGGATT
  ACACGGATCCCACAGGAGCTTGTGAAGAAGGGCCAGTTCCCCATCCCATCCATCACCTGGGAACACACAG
  GGCGGTATCGCTGTTACTATGGTAGCGACACTGCAGGCCGCTCAGAGAGCAGTGACCCCCTGGAGCTGGT
  GGTGACAGGAGCCTACATCAAACCCACCCTCTCAGCCCAGCCCAGCCCCGTGGTGAACTCAGGAGGGAAT
  GTAACCCTCCAGTGTGACTCACAGGTGGCATTTGATGGCTTCATTCTGTGTAAGGAAGGAGAAGATGAAC
  ACCCACAATGCCTGAACTCCCAGCCCCATGCCCGTGGGTCGTCCCGCGCCATCTTCTCCGTGGGCCCCGT
  GAGCCCGAGTCGCAGGTGGTGGTACAGGTGCTATGCTTATGACTCGAACTCTCCCTATGAGTGGTCTCTA
  CCCAGTGATCTCCTGGAGCTCCTGGTCCTAGGTGTTTCTAAGAAGCCATCACTCTCAGTGCAGCCAGGTC
  CTATCGTGGCCCCTGAGGAGACCCTGACTCTGCAGTGTGGCTCTGATGCTGGCTACAACAGATTTGTTCT
  GTATAAGGACGGGGAACGTGACTTCCTTCAGCTCGCTGGCGCACAGCCCCAGGCTGGGCTCTCCCAGGCC
  AACTTCACCCTGGGCCCTGTGAGCCGCTCCTACGGGGGCCAGTACAGATGCTACGGTGCACACAACCTCT
  CCTCCGAGTGGTCGGCCCCCAGCGACCCCCTGGACATCCTGATCGCAGGACAGTTCTATGACAGAGTCTC
  CCTCTCGGTGCAGCCGGGCCCCACGGTGGCCTCAGGAGAGAACGTGACCCTGCTGTGTCAGTCACAGGGA
  TGGATGCAAACTTTCCTTCTGACCAAGGAGGGGGCAGCTGATGACCCATGGCGTCTAAGATCAACGTACC
  AATCTCAAAAATACCAGGCTGAATTCCCCATGGGTCCTGTGACCTCAGCCCATGCGGGGACCTACAGGTG
  CTACGGCTCACAGAGCTCCAAACCCTACCTGCTGACTCACCCCAGTGACCCCCTGGAGCTCGTGGTCTCA
  GGACCGTCTGGGGGCCCCAGCTCCCCGACAACAGGCCCCACCTCCACATCTGCAGGCCCTGAGGACCAGC
  CCCTCACCCCCACCGGGTCGGATCCCCAGAGTGGTGAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001278399
• ORF Size: 1371 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001278399.2, NP_001265328.2
• RefSeq Size: 1690
• RefSeq ORF: 1371
• Locus ID: 10859
• Protein Families: Transmembrane
• Gene Summary: This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (6) has a shorter 5' UTR, lacks several exons, and its 3'-terminal exon extends past a splice site that is used in variant 1. The resulting protein (isoform 6) has a shorter and distinct C-terminus, compared to isoform 1. Isoform 6 lacks the transmembrane domain found in isoform 1 and is suspected to be soluble (PMID: 19658091). Sequence Note: A downstream translational start codon is selected for this RefSeq based on its better conservation in mammalian species and on the presence of a predicted signal peptide in the protein N-terminus. An upstream in-frame start codon is also present but is only conserved in primates, and use of the upstream start codon would result in a protein that is 17 aa longer at the N-terminus and lacks a predicted signal peptide. Leaky scanning by ribosomes may allow translation initiation at the downstream start codon.