PPP2R5E (NM_001282179) Human Untagged Clone
CAT#: SC336290
PPP2R5E (untagged) - Human protein phosphatase 2, regulatory subunit B', epsilon isoform (PPP2R5E), transcript variant 2
"NM_001282179" in other vectors (1)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PPP2R5E |
Synonyms | B56E; B56epsilon |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001282179, the custom clone sequence may differ by one or more nucleotides
ATGTCCTCAGCACCAACTACTCCTCCATCAGTGGATAAAGTAGACGGATTTTCTCGGAAGTCCGTCAGAA AAGCCAGACAGAAGAGGTCGCAAAGTTCCTCACAGTTTAGGTCTCAAGGCAAGCCTATTGAGTTAACACC TCTGCCGCTGCTAAAAGACGTTCCATCCTCAGAGCAGCCTGAACTGTTCCTAAAGAAACTTCAGCAGTGC TGTGTCATTTTTGACTTCATGGACACGCTATCTGATCTTAAAATGAAAGAATACAAGCGCTCCACTCTTA ATGAACTGGTGGACTACATTACAATAAGCAGAGGCTGTTTGACAGAGCAGACTTACCCTGAAGTAGTTAG AATGGTATCTTGCAATATATTCAGAACTCTCCCTCCTAGTGACAGCAATGAATTTGATCCAGAAGAAGAT GAACCTACCCTTGAGGCATCGTGGCCACACTTACAGCTTGTATATGAATTTTTCATACGATTTTTGGAAA GCCAAGAATTCCAACCCAGCATTGCCAAAAAATATATAGATCAGAAATTTGTATTACAGCTTCTGGAGCT ATTTGACAGCGAAGACCCTCGGGAACGGGACTACTTAAAAACAGTCTTACACAGAATTTATGGCAAGTTT CTTGGTCTTAGAGCATTTATCCGAAAACAGATTAACAATATTTTTCTAAGGTTTGTTTATGAAACAGAAC ACTTCAATGGTGTAGCTGAACTGCTGGAAATATTAGGAAGTATTATCAATGGCTTTGCTTTACCTCTTAA GGCAGAACACAAACAGTTTCTGGTGAAAGTATTGATCCCTTTACACACTGTCAGGAGCTTATCACTCTTC CATGCACAGCTGGCATATTGTATAGTACAGTTTCTGGAGAAAGATCCTTCACTCACAGAACCAGTTATTA GGGGGTTAATGAAATTTTGGCCTAAAACATGTAGTCAAAAAGAGGTCATGTTCCTTGGGGAACTGGAAGA AATATTGGATGTGATTGAACCTTCACAATTTGTTAAAATCCAAGAACCTTTGTTTAAACAAATCGCCAAG TGTGTATCTAGCCCCCATTTTCAGGTGGCAGAAAGAGCACTCTATTATTGGAATAATGAATACATCATGA GTTTGATAGAAGAAAACTCTAACGTCATCCTTCCCATCATGTTTTCCAGCCTTTATAGGATTTCAAAAGA ACATTGGAATCCGGCTATTGTGGCGTTGGTGTACAATGTGTTGAAGGCATTTATGGAAATGAACAGCACC ATGTTTGACGAGCTGACAGCCACATACAAGTCAGATCGTCAGCGTGAGAAAAAGAAAGAAAAGGAGCGTG AAGAATTGTGGAAAAAATTGGAGGATCTGGAGTTAAAGAGAGGTCTTAGACGTGATGGAATAATTCCAAC TTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282179 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001282179.1, NP_001269108.1 |
RefSeq Size | 4120 bp |
RefSeq ORF | 1404 bp |
Locus ID | 5529 |
Cytogenetics | 14q23.2 |
Protein Families | Druggable Genome, Phosphatase |
Protein Pathways | Oocyte meiosis, Wnt signaling pathway |
Gene Summary | 'The protein encoded by this gene belongs to the phosphatase 2A regulatory subunit B family. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes an epsilon isoform of the regulatory subunit B56 subfamily. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Aug 2013]' Transcript Variant: This variant (2) uses an alternate splice junction in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC238396 | PPP2R5E (myc-DDK-tagged) - Human protein phosphatase 2, regulatory subunit B', epsilon isoform (PPP2R5E), transcript variant 2 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review