EYA1 (NM_001288575) Human Untagged Clone

CAT#: SC336314

EYA1 (untagged) - Human EYA transcriptional coactivator and phosphatase 1 (EYA1), transcript variant 6


  "NM_001288575" in other vectors (1)

Reconstitution Protocol

USD 470.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "EYA1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol EYA1
Synonyms BOP; BOR; BOS1; OFC1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001288575, the custom clone sequence may differ by one or more nucleotides


ATGCAACAAGCTACAGCCTATGCCACGTACCCACAGCCAGGACAGCCGTACGGCATTTCCTCATATGGCA
TCAAGACTGAAGGTGGATTGTCACAGTCTCAGTCACCTGGACAGACAGGATTTCTCAGCTATGGCACAAG
CTTCAGTACCCCTCAACCTGGACAGGCACCATACAGCTACCAGATGCAAGGTAGCAGTTTTACAACATCA
TCAGGAATATATACAGGAAATAATTCACTCACAAATTCCTCTGGATTTAATAGTTCACAGCAGGACTATC
CGTCTTATCCCAGTTTTGGCCAGGGTCAGTACGCACAGTATTATAACAGCTCACCGTATCCAGCACATTA
TATGACCAGCAGCAACACCAGCCCAACGACACCATCCACCAATGCCACTTACCAGCTTCAAGAACCGCCA
TCTGGCATCACCAGCCAAGCAGTTACAGATCCCACAGCAGAGTACAGCACAATCCACAGCCCATCAACAC
CCATTAAAGATTCAGATTCTGATCGATTGCGTCGAGGTTCAGATGGGAAATCACGTGGACGGGGCCGAAG
AAACAATAATCCTTCACCTCCCCCAGATTCTGATCTTGAGAGAGTGTTCATCTGGGACTTGGATGAGACA
ATCATTGTTTTCCACTCCTTGCTTACTGGGTCCTACGCCAACAGATATGGGAGGGATCCACCCACTTCAG
TTTCCCTTGGACTGCGAATGGAAGAAATGATTTTCAACTTGGCAGACACACATTTATTTTTTAATGACTT
AGAAGAATGTGACCAAGTCCATATAGATGATGTTTCTTCAGATGATAACGGACAGGACCTAAGCACATAT
AACTTTGGAACAGATGGCTTTCCTGCTGCAGCAACCAGTGCTAACTTATGTTTGGCAACTGGTGTACGGG
GCGGTGTGGACTGGATGAGAAAGTTGGCCTTCCGCTACAGACGGGTAAAAGAGATCTACAACACCTACAA
AAATAATGTTGGAGGTCTGCTTGGTCCAGCTAAGAGGGAAGCCTGGCTGCAGTTGAGGGCCGAAATTGAA
GCCCTGACCGACTCCTGGTTGACACTGGCCCTGAAAGCACTCTCGCTCATTCACTCCCGGACAAACTGTG
TGAATATTTTAGTAACAACTACTCAGCTCATCCCAGCATTGGCGAAAGTCCTGCTGTATGGGTTAGGAAT
TGTATTTCCAATAGAAAATATTTACAGTGCAACTAAAATAGGAAAAGAAAGCTGTTTTGAGAGAATAATT
CAAAGGTTTGGAAGAAAAGTGGTGTATGTTGTTATAGGAGATGGTGTAGAAGAAGAACAAGGAGCAAAAA
AGCACGCGATGCCCTTCTGGAGGATCTCCAGCCACTCGGACCTCATGGCCCTGCACCATGCCTTGGAACT
GGAGTACCTGTAA


Restriction Sites SgfI-MluI     
ACCN NM_001288575
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001288575.1, NP_001275504.1
RefSeq Size 4259 bp
RefSeq ORF 1413 bp
Locus ID 2138
Cytogenetics 8q13.3
Protein Families Druggable Genome, Phosphatase, Transcription Factors
Gene Summary 'This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may play a role in the developing kidney, branchial arches, eye, and ear. Mutations of this gene have been associated with branchiootorenal dysplasia syndrome, branchiootic syndrome, and sporadic cases of congenital cataracts and ocular anterior segment anomalies. A similar protein in mice can act as a transcriptional activator. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Dec 2013]'
Transcript Variant: This variant (6) uses alternate acceptor splice sites at two internal exons, the first of which causes translation initiation from an in-frame downstream start codon compared to variant EYA1C. The resulting isoform (5) has a shorter N-terminus and lacks a 5 aa protein segment compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.