NFAT2 (NFATC1) (NM_001278673) Human Untagged Clone
CAT#: SC336317
NFATC1 (untagged) - Human nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1 (NFATC1), transcript variant 10
"NM_001278673" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NFATC1 |
Synonyms | NF-ATC; NF-ATc1.2; NFAT2; NFATc |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001278673, the custom clone sequence may differ by one or more nucleotides
ATGCTGCAGCTTTTCATTGGGACGGCGGACGACCGCCTGCTGCGCCCGCACGCCTTCTACCAGGTGCACC GCATCACAGGGAAGACCGTGTCCACCACCAGCCACGAGGCCATCCTCTCCAACACCAAAGTCCTGGAGAT CCCACTCCTGCCGGAGAACAGCATGCGAGCCGTCATTGACTGTGCCGGAATCCTGAAACTCAGAAACTCC GACATTGAACTTCGGAAAGGAGAGACGGACATCGGGAGGAAGAACACACGGGTACGGCTGGTGTTCCGCG TTCACGTCCCGCAACCCAGCGGCCGCACGCTGTCCCTGCAGGTGGCCTCCAACCCCATCGAATGCTCCCA GCGCTCAGCTCAGGAGCTGCCTCTGGTGGAGAAGCAGAGCACGGACAGCTATCCGGTCGTGGGCGGGAAG AAGATGGTCCTGTCTGGCCACAACTTCCTGCAGGACTCCAAGGTCATTTTCGTGGAGAAAGCCCCAGATG GCCACCATGTCTGGGAGATGGAAGCGAAAACTGACCGGGACCTGTGCAAGCCGAATTCTCTGGTGGTTGA GATCCCGCCATTTCGGAATCAGAGGATAACCAGCCCCGTTCACGTCAGTTTCTACGTCTGCAACGGGAAG AGAAAGCGAAGCCAGTACCAGCGTTTCACCTACCTTCCCGCCAACGTTCCAATTATAAAAACAGAACCCA CTGATGATTATGAGCCTGCTCCAACCTGTGGACCGGTGAGCCAGGGGTTAAGTCCTCTCCCAAGACCATA CTACAGCCAGCAGCTCGCGATGCCACCCGACCCCAGCTCCTGCCTCGTGGCCGGCTTCCCGCCCTGTCCG CAGAGAAGCACCCTGATGCCAGCGGCCCCTGGCGTGAGCCCCAAGCTCCACGACCTTTCTCCCGCTGCCT ACACCAAGGGCGTTGCCAGCCCGGGCCACTGTCACCTCGGACTCCCGCAGCCGGCCGGAGAGGCCCCCGC CGTCCAGGACGTGCCCAGGCCAGTGGCCACGCACCCCGGCTCGCCCGGGCAGCCACCCCCGGCCCTGCTG CCACAGCAGGTGAGTGCGCCTCCAAGCAGTAGCTGCCCCCCTGGTCTCGAACACTCGCTCTGCCCCAGCA GCCCCTCTCCTCCACTCCCGCCTGCCACCCAAGAGCCGACCTGCCTGCAGCCCTGCAGCCCAGCGTGCCC GCCCGCCACGGGCCGCCCGCAGCACCTGCCGTCCACGGTCCGCAGGGACGAGTCTCCGACTGCCGGGCCA CGGCTGCTGCCAGAGGTGCATGAGGACGGTAGTCCTAATTTGGCCCCTATTCCTGTAACGGTCAAGCGAG AGCCTGAAGAGTTGGACCAGTTGTACCTGGATGACGTAAATGAAATAATACGAAATGACCTCTCCAGCAC GAGCACCCACTCCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001278673 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001278673.1, NP_001265602.1 |
RefSeq Size | 3558 bp |
RefSeq ORF | 1416 bp |
Locus ID | 4772 |
Cytogenetics | 18q23 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | Axon guidance, B cell receptor signaling pathway, Natural killer cell mediated cytotoxicity, T cell receptor signaling pathway, VEGF signaling pathway, Wnt signaling pathway |
Gene Summary | 'The product of this gene is a component of the nuclear factor of activated T cells DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor (TCR) stimulation, and an inducible nuclear component. Proteins belonging to this family of transcription factors play a central role in inducible gene transcription during immune response. The product of this gene is an inducible nuclear component. It functions as a major molecular target for the immunosuppressive drugs such as cyclosporin A. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Different isoforms of this protein may regulate inducible expression of different cytokine genes. [provided by RefSeq, Jul 2013]' Transcript Variant: This variant (10) has an alternate 5' terminal exon and lacks an internal exon in the 5' region, which results in a downstream translation start codon, compared to variant 6. The encoded isoform (J) is shorter at the N-terminus, compared to isoform F. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC238423 | NFATC1 (myc-DDK-tagged) - Human nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1 (NFATC1), transcript variant 10 |
USD 490.00 |
{0} Product Review(s)
Be the first one to submit a review