PFKFB3 (NM_001282630) Human Untagged Clone

CAT#: SC336656

PFKFB3 (untagged) - Human 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 (PFKFB3), transcript variant 3


  "NM_001282630" in other vectors (1)

Reconstitution Protocol

USD 540.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "PFKFB3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PFKFB3
Synonyms iPFK-2; IPFK2; PFK2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001282630, the custom clone sequence may differ by one or more nucleotides


ATGGGGGAGGGTGGCCAGAAGGAAGGTGACAGCCAGCAAGCAGGGGCTCTGCCACTCCTCTGTCAGCTGG
ACACGTTTAGTCCCAAGGCCACTGTCTTCGGTGTCTCCATTAATCCAGCCTGTGGGCCAAAGCTGACCAA
CTCCCCCACCGTCATCGTCATGGTGGGCCTCCCCGCCCGGGGCAAGACCTACATCTCCAAGAAGCTGACT
CGCTACCTCAACTGGATTGGCGTCCCCACAAAAGTGTTCAACGTCGGGGAGTATCGCCGGGAGGCTGTGA
AGCAGTACAGCTCCTACAACTTCTTCCGCCCCGACAATGAGGAAGCCATGAAAGTCCGGAAGCAATGTGC
CTTAGCTGCCTTGAGAGATGTCAAAAGCTACCTGGCGAAAGAAGGGGGACAAATTGCGGTTTTCGATGCC
ACCAATACTACTAGAGAGAGGAGACACATGATCCTTCATTTTGCCAAAGAAAATGACTTTAAGGCGTTTT
TCATCGAGTCGGTGTGCGACGACCCTACAGTTGTGGCCTCCAATATCATGGAAGTTAAAATCTCCAGCCC
GGATTACAAAGACTGCAACTCGGCAGAAGCCATGGACGACTTCATGAAGAGGATCAGTTGCTATGAAGCC
AGCTACCAGCCCCTCGACCCCGACAAATGCGACAGGGACTTGTCGCTGATCAAGGTGATTGACGTGGGCC
GGAGGTTCCTGGTGAACCGGGTGCAGGACCACATCCAGAGCCGCATCGTGTACTACCTGATGAACATCCA
CGTGCAGCCGCGTACCATCTACCTGTGCCGGCACGGCGAGAACGAGCACAACCTCCAGGGCCGCATCGGG
GGCGACTCAGGCCTGTCCAGCCGGGGCAAGAAGTTTGCCAGTGCTCTGAGCAAGTTCGTGGAGGAGCAGA
ACCTGAAGGACCTGCGCGTGTGGACCAGCCAGCTGAAGAGCACCATCCAGACGGCCGAGGCGCTGCGGCT
GCCCTACGAGCAGTGGAAGGCGCTCAATGAGATCGACGCGGGCGTCTGTGAGGAGCTGACCTACGAGGAG
ATCAGGGACACCTACCCTGAGGAGTATGCGCTGCGGGAGCAGGACAAGTACTATTACCGCTACCCCACCG
GGGAGTCCTACCAGGACCTGGTCCAGCGCTTGGAGCCAGTGATCATGGAGCTGGAGCGGCAGGAGAATGT
GCTGGTCATCTGCCACCAGGCCGTCCTGCGCTGCCTGCTTGCCTACTTCCTGGATAAGAGTGCAGAGGAG
ATGCCCTACCTGAAATGCCCTCTTCACACCGTCCTGAAACTGACGCCTGTCGCTTATGGCTGCCGTGTGG
AATCCATCTACCTGAACGTGGAGTCCGTCTGCACACACCGGGAGAGGTCAGAGGATGCAAAGAAGGGACC
TAACCCGCTCATGAGACGCAATAGTGTCACCCCGCTAGCCAGCCCCGAACCCACCAAAAAGCCTCGCATC
AACAGCTTTGAGGAGCATGTGGCCTCCACCTCGGCCGCCCTGCCCAGCTGCCTGCCCCCGGAGGTGCCCA
CGCAGCTGCCTGGACAAAACATGAAAGGCTCCCGGAGCAGCGCTGACTCCTCCAGGAAACACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001282630
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282630.2, NP_001269559.1
RefSeq Size 4339 bp
RefSeq ORF 1605 bp
Locus ID 5209
Cytogenetics 10p15.1
Protein Families Druggable Genome
Protein Pathways Fructose and mannose metabolism
Gene Summary 'The protein encoded by this gene belongs to a family of bifunctional proteins that are involved in both the synthesis and degradation of fructose-2,6-bisphosphate, a regulatory molecule that controls glycolysis in eukaryotes. The encoded protein has a 6-phosphofructo-2-kinase activity that catalyzes the synthesis of fructose-2,6-bisphosphate (F2,6BP), and a fructose-2,6-biphosphatase activity that catalyzes the degradation of F2,6BP. This protein is required for cell cycle progression and prevention of apoptosis. It functions as a regulator of cyclin-dependent kinase 1, linking glucose metabolism to cell proliferation and survival in tumor cells. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2016]'
Transcript Variant: This variant (3) uses an alternate 5' terminal exon compared to variant 1. The resulting isoform (3) has a longer and distinct N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.