Human CFTR activation kit by CRISPRa
CAT#: GA100776
CFTR CRISPRa kit - CRISPR gene activation of human CF transmembrane conductance regulator
Find the corresponding CRISPRi Inhibitor Kit
USD 1,290.00
2 Weeks*
Specifications
| Product Data | |
| Format | 3gRNAs, 1 scramble ctrl and 1 enhancer vector |
| Symbol | CFTR |
| Locus ID | 1080 |
| Kit Components | GA100776G1, CFTR gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGAGGAGGAGGAGGAAGGC GA100776G2, CFTR gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTTTTCCCGATGATCCTAGT GA100776G3, CFTR gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAGGCAGGCTCCGGGGAAGC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
| Disclaimer | The kit is designed based on the best knowledge of CRISPa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc. |
| Reference Data | |
| RefSeq | NM_000492 |
| Synonyms | ABC35; ABCC7; CF; CFTR/MRP; dJ760C5.1; MRP7; TNR-CFTR |
| Summary | 'This gene encodes a member of the ATP-binding cassette (ABC) transporter superfamily. The encoded protein functions as a chloride channel, making it unique among members of this protein family, and controls ion and water secretion and absorption in epithelial tissues. Channel activation is mediated by cycles of regulatory domain phosphorylation, ATP-binding by the nucleotide-binding domains, and ATP hydrolysis. Mutations in this gene cause cystic fibrosis, the most common lethal genetic disorder in populations of Northern European descent. The most frequently occurring mutation in cystic fibrosis, DeltaF508, results in impaired folding and trafficking of the encoded protein. Multiple pseudogenes have been identified in the human genome. [provided by RefSeq, Aug 2017]' |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| KN216476 | CFTR - human gene knockout kit via CRISPR, HDR mediated |
USD 1,290.00 |
|
| KN216476BN | CFTR - human gene knockout kit via CRISPR, HDR mediated |
USD 1,290.00 |
|
| KN216476LP | CFTR - human gene knockout kit via CRISPR, HDR mediated |
USD 1,290.00 |
|
| KN216476RB | CFTR - human gene knockout kit via CRISPR, HDR mediated |
USD 1,290.00 |
|
| KN416476 | CFTR - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
USD 1,290.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China