Human CFTR activation kit by CRISPRa

CAT#: GA100776

CFTR CRISPRa kit - CRISPR gene activation of human CF transmembrane conductance regulator

  See Other Versions


Find the corresponding CRISPRi Inhibitor Kit

USD 1,290.00

2 Weeks*

Size
    • 1 kit

Product Images

Frequently bought together (2)
Rabbit Polyclonal anti-CFTR Antibody
    • 100 ul

USD 345.00


qSTAR qPCR primer pairs against Homo sapiens gene CFTR
    • 200 reactions

USD 120.00

Other products for "CFTR"

Specifications

Product Data
Format 3gRNAs, 1 scramble ctrl and 1 enhancer vector
Symbol CFTR
Locus ID 1080
Kit Components

GA100776G1, CFTR gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGAGGAGGAGGAGGAAGGC

GA100776G2, CFTR gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTTTTCCCGATGATCCTAGT

GA100776G3, CFTR gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAGGCAGGCTCCGGGGAAGC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Disclaimer The kit is designed based on the best knowledge of CRISPa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq NM_000492
Synonyms ABC35; ABCC7; CF; CFTR/MRP; dJ760C5.1; MRP7; TNR-CFTR
Summary 'This gene encodes a member of the ATP-binding cassette (ABC) transporter superfamily. The encoded protein functions as a chloride channel, making it unique among members of this protein family, and controls ion and water secretion and absorption in epithelial tissues. Channel activation is mediated by cycles of regulatory domain phosphorylation, ATP-binding by the nucleotide-binding domains, and ATP hydrolysis. Mutations in this gene cause cystic fibrosis, the most common lethal genetic disorder in populations of Northern European descent. The most frequently occurring mutation in cystic fibrosis, DeltaF508, results in impaired folding and trafficking of the encoded protein. Multiple pseudogenes have been identified in the human genome. [provided by RefSeq, Aug 2017]'

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.