Human Oxytocin neurophysin 1 (OXT) activation kit by CRISPRa

CAT#: GA103350

OXT CRISPRa kit - CRISPR gene activation of human oxytocin/neurophysin I prepropeptide

  See Other Versions


Find the corresponding CRISPRi Inhibitor Kit

USD 1,290.00

2 Weeks*

Size
    • 1 kit

Product Images

Frequently bought together (2)
OXT mouse monoclonal antibody, clone OTI5G4 (formerly 5G4)
    • 100 ul

USD 447.00


qSTAR qPCR primer pairs against Homo sapiens gene OXT
    • 200 reactions

USD 120.00

Specifications

Product Data
Format 3gRNAs, 1 scramble ctrl and 1 enhancer vector
Symbol OXT
Locus ID 5020
Kit Components

GA103350G1, Oxytocin neurophysin 1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCACTAGAATATAAGCCCCA

GA103350G2, Oxytocin neurophysin 1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCCTTTTATCTCTGTAGCAC

GA103350G3, Oxytocin neurophysin 1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATGTCCCCTCAGATATCTGC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Disclaimer The kit is designed based on the best knowledge of CRISPa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq NM_000915
Synonyms OT; OT-NPI; OXT-NPI
Summary 'This gene encodes a precursor protein that is processed to produce oxytocin and neurophysin I. Oxytocin is a posterior pituitary hormone which is synthesized as an inactive precursor in the hypothalamus along with its carrier protein neurophysin I. Together with neurophysin, it is packaged into neurosecretory vesicles and transported axonally to the nerve endings in the neurohypophysis, where it is either stored or secreted into the bloodstream. The precursor seems to be activated while it is being transported along the axon to the posterior pituitary. This hormone contracts smooth muscle during parturition and lactation. It is also involved in cognition, tolerance, adaptation and complex sexual and maternal behaviour, as well as in the regulation of water excretion and cardiovascular functions. [provided by RefSeq, Dec 2013]'

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.