POLR1C (NM_004875) Human 3' UTR Clone

CAT#: SC200020

3`UTR clone of polymerase (RNA) I polypeptide C 30kDa (POLR1C) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: POLR1C
• Synonyms: RP3-337H4.4; RPA5; RPA39; RPA40; RPAC1; TCS3
• ACCN: NM_004875
• Insert Size: 20
• Sequence Data:
  Insert Sequence

  >SC200020 3'UTR clone of NM_004875
  The sequence shown below is from the reference sequence of NM_004875. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CGAGACCATCCTGGCTAACA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_004875.2
• Summary: The protein encoded by this gene is a subunit of both RNA polymerase I and RNA polymerase III complexes. The encoded protein is part of the Pol core element. Mutations in this gene have been associated with Treacher Collins syndrome (TCS) and hypomyelinating leukodystrophy 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
• Locus ID: 9533