PRPS1L1 (NM_175886) Human 3' UTR Clone

CAT#: SC200033

3`UTR clone of phosphoribosyl pyrophosphate synthetase 1-like 1 (PRPS1L1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PRPS1L1
• Synonyms: PRPS1; PRPS3; PRPSL; PRS-III
• ACCN: NM_175886
• Insert Size: 63
• Sequence Data:
  Insert Sequence

  >SC200033 3'UTR clone of NM_175886
  The sequence shown below is from the reference sequence of NM_175886. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTTTCCTACCTGTTCAGCCATGTTCCTTTATAACAGAATAACTTCTAGGTTATGCTATTTTAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_175886.2
• Summary: This intronless gene is specifically expressed in the testis, and encodes a protein that is highly homologous to the two subunits of phosphoribosylpyrophosphate synthetase encoded by human X-linked genes, PRPS1 and PRPS2. These enzymes convert pyrimidine, purine or pyridine bases to the corresponding ribonucleoside monophosphates. In vitro transcription/translation and site-directed mutagenesis studies indicate that translation of this mRNA initiates exclusively at a non-AUG (ACG) codon. [provided by RefSeq, Jul 2008]
• Locus ID: 221823