WNT9A (NM_003395) Human 3' UTR Clone
CAT#: SC200039
3`UTR clone of wingless-type MMTV integration site family member 9A (WNT9A) for miRNA target validation
Product Images
![](https://cdn.origene.com/img/defaults-img.jpg)
Other products for "WNT9A"
Specifications
Product Data | |
Vector | pMirTarget |
Species | Human |
Transfection Reporter | RFP |
Assay Reporter | Luciferase |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Symbol | WNT9A |
Synonyms | WNT14 |
ACCN | NM_003395 |
Insert Size | 86 bp |
Sequence Data |
>SC200039 3'UTR clone of NM_003395
The sequence shown below is from the reference sequence of NM_003395. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon CAATTGGCAGAGCTCAGAATTCAAGCGATCGC AGCGTGAGGAGGTCTACACCTGCAAGGGCTGAGTTCCCAGGCCCTGCCAGCCCTGCTGCACAGGGTGCAG GCATTGCACACGGTGT ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG |
Restriction Sites | SgfI-MluI |
OTI Disclaimer | Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. |
Reference Data | |
RefSeq | NM_003395.2 |
Summary | 'The WNT gene family consists of structurally related genes that encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It is expressed in gastric cancer cell lines. The protein encoded by this gene shows 75% amino acid identity to chicken Wnt14, which has been shown to play a central role in initiating synovial joint formation in the chick limb. This gene is clustered with another family member, WNT3A, in the chromosome 1q42 region. [provided by RefSeq, Jul 2008]' |
Locus ID | 7483 |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.