Apolipoprotein A I (APOA1) (NM_000039) Human 3' UTR Clone

CAT#: SC200054

3`UTR clone of apolipoprotein A-I (APOA1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: APOA1
• Synonyms: apo(a); HPALP2
• ACCN: NM_000039
• Insert Size: 61 bp
• Sequence Data:
  Insert Sequence

  >SC200054 3'UTR clone of NM_000039
  The sequence shown below is from the reference sequence of NM_000039. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAAGCTCAACACCCAGTGAGGCGCCCGCCGCCGCCCCCCTTCCCGGTGCTCAGAATAAACG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000039.1
• Summary: 'This gene encodes apolipoprotein A-I, which is the major protein component of high density lipoprotein (HDL) in plasma. The encoded preproprotein is proteolytically processed to generate the mature protein, which promotes cholesterol efflux from tissues to the liver for excretion, and is a cofactor for lecithin cholesterolacyltransferase (LCAT), an enzyme responsible for the formation of most plasma cholesteryl esters. This gene is closely linked with two other apolipoprotein genes on chromosome 11. Defects in this gene are associated with HDL deficiencies, including Tangier disease, and with systemic non-neuropathic amyloidosis. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein. [provided by RefSeq, Dec 2015]'
• Locus ID: 335