HIST3H2A (NM_033445) Human 3' UTR Clone

CAT#: SC200127

3`UTR clone of histone cluster 3 H2a (HIST3H2A) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HIST3H2A
• Synonyms: MGC3165
• ACCN: NM_033445
• Insert Size: 95
• Sequence Data:
  Insert Sequence

  >SC200127 3'UTR clone of NM_033445
  The sequence shown below is from the reference sequence of NM_033445. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAAGAAGACGGAGAGCCACCACAAGGCCAAGGGCAAGTGAGGCCGCCCGCCGCCCCCGGGGCCCCTTTGA
  TGGACATAAAGGCTCTTTTCAGAGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_033445.2
• Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2A family. Transcripts from this gene contain a palindromic termination element. [provided by RefSeq, Aug 2015]
• Locus ID: 92815