DARC (ACKR1) (NM_002036) Human 3' UTR Clone
CAT#: SC200182
3`UTR clone of Duffy blood group chemokine receptor (DARC) transcript variant 2 for miRNA target validation
Product Images
Other products for "ACKR1"
Specifications
Product Data | |
Vector | pMirTarget |
Species | Human |
Transfection Reporter | RFP |
Assay Reporter | Luciferase |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Symbol | ACKR1 |
Synonyms | CCBP1; CD234; DARC; DARC/ACKR1; Dfy; FY; GPD; GpFy; WBCQ1 |
ACCN | NM_002036 |
Insert Size | 58 bp |
Sequence Data |
>SC200182 3'UTR clone of NM_002036
The sequence shown below is from the reference sequence of NM_002036. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon CAATTGGCAGAGCTCAGAATTCAAGCGATCGC GGTCTTCTCATCTGGACACCCTTGGAAGCAAATCCTAGTTCTCTTCCCACCTGTCAAC ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG |
Restriction Sites | SgfI-MluI |
OTI Disclaimer | Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. |
Reference Data | |
RefSeq | NM_002036.2 |
Summary | 'The protein encoded by this gene is a glycosylated membrane protein and a non-specific receptor for several chemokines. The encoded protein is the receptor for the human malarial parasites Plasmodium vivax and Plasmodium knowlesi. Polymorphisms in this gene are the basis of the Duffy blood group system. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]' |
Locus ID | 2532 |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.