Endo G (ENDOG) (NM_004435) Human 3' UTR Clone

CAT#: SC200183

3`UTR clone of endonuclease G (ENDOG) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ENDOG
• Synonyms: FLJ27463
• ACCN: NM_004435
• Insert Size: 79 bp
• Sequence Data:
  Insert Sequence

  >SC200183 3'UTR clone of NM_004435
  The sequence shown below is from the reference sequence of NM_004435. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CATCACGGCGGGCAGTAAGTGAGGGTGGAGCCCAGTGAGACTGTGGGTGTGTGCAGGCCGGGGAGTATTA
  AAGGTGGTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004435.2
• Summary: 'The protein encoded by this gene is a nuclear encoded endonuclease that is localized in the mitochondrion. The encoded protein is widely distributed among animals and cleaves DNA at GC tracts. This protein is capable of generating the RNA primers required by DNA polymerase gamma to initiate replication of mitochondrial DNA. [provided by RefSeq, Jul 2008]'
• Locus ID: 2021