ELOB (NM_207013) Human 3' UTR Clone
CAT#: SC200185
3`UTR clone of transcription elongation factor B (SIII) polypeptide 2 (18kDa elongin B) (TCEB2) transcript variant 2 for miRNA target validation
Product Images
Other products for "ELOB"
Specifications
Product Data | |
Vector | pMirTarget |
Species | Human |
Transfection Reporter | RFP |
Assay Reporter | Luciferase |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Symbol | ELOB |
Synonyms | SIII; TCEB2 |
ACCN | NM_207013 |
Insert Size | 71 bp |
Sequence Data |
>SC200185 3'UTR clone of NM_207013
The sequence shown below is from the reference sequence of NM_207013. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon CAATTGGCAGAGCTCAGAATTCAAGCGATCGC CCAAGACGGACCCACACAGGTCCACCCACGCTGGGGGCTGTAATCACGGAGGGAAGTGGCTGCCCCCTTA A ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG |
Restriction Sites | SgfI-MluI |
OTI Disclaimer | Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. |
Reference Data | |
RefSeq | NM_207013.1 |
Summary | 'This gene encodes the protein elongin B, which is a subunit of the transcription factor B (SIII) complex. The SIII complex is composed of elongins A/A2, B and C. It activates elongation by RNA polymerase II by suppressing transient pausing of the polymerase at many sites within transcription units. Elongin A functions as the transcriptionally active component of the SIII complex, whereas elongins B and C are regulatory subunits. Elongin A2 is specifically expressed in the testis, and capable of forming a stable complex with elongins B and C. The von Hippel-Lindau tumor suppressor protein binds to elongins B and C, and thereby inhibits transcription elongation. Two alternatively spliced transcript variants encoding different isoforms have been described for this gene. Pseudogenes have been identified on chromosomes 11 and 13. [provided by RefSeq, Aug 2008]' |
Locus ID | 6923 |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.