Lymphocyte Activation Gene 3 (LAG3) (NM_002286) Human 3' UTR Clone

CAT#: SC200202

3`UTR clone of lymphocyte-activation gene 3 (LAG3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: LAG3
• Synonyms: CD223
• ACCN: NM_002286
• Insert Size: 60 bp
• Sequence Data:
  Insert Sequence

  >SC200202 3'UTR clone of NM_002286
  The sequence shown below is from the reference sequence of NM_002286. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCCGGAGCAGCTCTGACCTGGAGCTGAGGCAGCCAGCAGATCTCAGCAGCCCAGTCCAAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002286.5
• Summary: 'Lymphocyte-activation protein 3 belongs to Ig superfamily and contains 4 extracellular Ig-like domains. The LAG3 gene contains 8 exons. The sequence data, exon/intron organization, and chromosomal localization all indicate a close relationship of LAG3 to CD4. [provided by RefSeq, Jul 2008]'
• Locus ID: 3902