CNOT1 (NM_206999) Human 3' UTR Clone
CAT#: SC200238
3`UTR clone of CCR4-NOT transcription complex subunit 1 (CNOT1) transcript variant 2 for miRNA target validation
Product Images
![](https://cdn.origene.com/img/defaults-img.jpg)
Other products for "CNOT1"
Specifications
Product Data | |
Vector | pMirTarget |
Species | Human |
Transfection Reporter | RFP |
Assay Reporter | Luciferase |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Symbol | CNOT1 |
Synonyms | AD-005; CDC39; NOT1; NOT1H |
ACCN | NM_206999 |
Insert Size | 54 |
Sequence Data |
>SC200238 3'UTR clone of NM_206999
The sequence shown below is from the reference sequence of NM_206999. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon CAATTGGCAGAGCTCAGAATTCAAGCGATCGC GTTATATTCTCAACACGATGTTTGACAGATAGTAGATACCCAAATATTTGTTGG ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG |
Restriction Sites | SgfI-MluI |
OTI Disclaimer | Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). |
Reference Data | |
RefSeq | NM_206999.1 |
Locus ID | 23019 |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.