FABP6 (NM_001040442) Human 3' UTR Clone

CAT#: SC200249

3`UTR clone of fatty acid binding protein 6 ileal (FABP6) transcript variant 1 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "FABP6"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol FABP6
Synonyms I-15P; I-BABP; I-BALB; I-BAP; ILBP; ILBP3; ILLBP
ACCN NM_001040442
Insert Size 84 bp
Sequence Data
>SC200249 3'UTR clone of NM_001040442
The sequence shown below is from the reference sequence of NM_001040442. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CATCGGAGGCGTGACCTATGAGCGCGTGAGCAAGAGACTGGCCTAAGCAGCCAGGCCCGGCCCAGGGAGC
TACAAACCCACCAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001040442.1
Summary 'This gene encodes the ileal fatty acid binding protein. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABP6 and FABP1 (the liver fatty acid binding protein) are also able to bind bile acids. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. Transcript variants generated by alternate transcription promoters and/or alternate splicing have been found for this gene. [provided by RefSeq, Jul 2008]'
Locus ID 2172

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.