PNK (PNKP) (NM_007254) Human 3' UTR Clone

CAT#: SC200261

3`UTR clone of polynucleotide kinase 3'-phosphatase (PNKP) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PNKP
• Synonyms: AOA4; EIEE10; MCSZ; PNK
• ACCN: NM_007254
• Insert Size: 59
• Sequence Data:
  Insert Sequence

  >SC200261 3'UTR clone of NM_007254
  The sequence shown below is from the reference sequence of NM_007254. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGTACTGCCAGTTCTCCGAGGGCTGAGCCCCGCCCAGCTCCCCTCCACAATAAACGCTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_007254.2
• Summary: This locus represents a gene involved in DNA repair. In response to ionizing radiation or oxidative damage, the protein encoded by this locus catalyzes 5' phosphorylation and 3' dephosphorylation of nucleic acids. Mutations at this locus have been associated with microcephaly, seizures, and developmental delay. [provided by RefSeq, Sep 2010]
• Locus ID: 11284