NDUFV2 (NM_021074) Human 3' UTR Clone

CAT#: SC200266

3`UTR clone of NADH dehydrogenase (ubiquinone) flavoprotein 2 24kDa (NDUFV2) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NDUFV2
• Synonyms: CI-24k; MC1DN7
• ACCN: NM_021074
• Insert Size: 92 bp
• Sequence Data:
  Insert Sequence

  >SC200266 3'UTR clone of NM_021074
  The sequence shown below is from the reference sequence of NM_021074. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGACCTGGATTTGGTGTACAAGCAGGCCTTTAATTTATATTGAACTGTAAATATGTCACTAGAGAAATAA
  AATATGGACTTCCAATCTACGT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_021074.4
• Summary: 'The NADH-ubiquinone oxidoreductase complex (complex I) of the mitochondrial respiratory chain catalyzes the transfer of electrons from NADH to ubiquinone, and consists of at least 43 subunits. The complex is located in the inner mitochondrial membrane. This gene encodes the 24 kDa subunit of complex I, and is involved in electron transfer. Mutations in this gene are implicated in Parkinson's disease, bipolar disorder, schizophrenia, and have been found in one case of early onset hypertrophic cardiomyopathy and encephalopathy. A non-transcribed pseudogene of this locus is found on chromosome 19. [provided by RefSeq, Oct 2009]'
• Locus ID: 4729