IRS4 (NM_003604) Human 3' UTR Clone

CAT#: SC200276

3`UTR clone of insulin receptor substrate 4 (IRS4) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: IRS4
• Synonyms: IRS-4; PY160
• ACCN: NM_003604
• Insert Size: 82
• Sequence Data:
  Insert Sequence

  >SC200276 3'UTR clone of NM_003604
  The sequence shown below is from the reference sequence of NM_003604. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTCCCAAAAGAGGTCGGTAATTTTAGAATTAATTTCCCTAAAGTGAATGGTCATTGTCTAATGATTCGAT
  GCGCTACAGTCT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_003604.2
• Summary: IRS4 encodes the insulin receptor substrate 4, a cytoplasmic protein that contains many potential tyrosine and serine/threonine phosphorylation sites. Tyrosine-phosphorylated IRS4 protein has been shown to associate with cytoplasmic signalling molecules that contain SH2 domains. The IRS4 protein is phosphorylated by the insulin receptor tyrosine kinase upon receptor stimulation.. [provided by RefSeq, Jul 2008]
• Locus ID: 8471