IRS4 (NM_003604) Human 3' UTR Clone
CAT#: SC200276
3`UTR clone of insulin receptor substrate 4 (IRS4) for miRNA target validation
Product Images
![](https://cdn.origene.com/img/defaults-img.jpg)
Other products for "IRS4"
Specifications
Product Data | |
Vector | pMirTarget |
Species | Human |
Transfection Reporter | RFP |
Assay Reporter | Luciferase |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Symbol | IRS4 |
Synonyms | IRS-4; PY160 |
ACCN | NM_003604 |
Insert Size | 82 |
Sequence Data |
>SC200276 3'UTR clone of NM_003604
The sequence shown below is from the reference sequence of NM_003604. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon CAATTGGCAGAGCTCAGAATTCAAGCGATCGC CTCCCAAAAGAGGTCGGTAATTTTAGAATTAATTTCCCTAAAGTGAATGGTCATTGTCTAATGATTCGAT GCGCTACAGTCT ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG |
Restriction Sites | SgfI-MluI |
OTI Disclaimer | Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). |
Reference Data | |
RefSeq | NM_003604.2 |
Summary | IRS4 encodes the insulin receptor substrate 4, a cytoplasmic protein that contains many potential tyrosine and serine/threonine phosphorylation sites. Tyrosine-phosphorylated IRS4 protein has been shown to associate with cytoplasmic signalling molecules that contain SH2 domains. The IRS4 protein is phosphorylated by the insulin receptor tyrosine kinase upon receptor stimulation.. [provided by RefSeq, Jul 2008] |
Locus ID | 8471 |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.