RPA14 (RPA3) (NM_002947) Human 3' UTR Clone
CAT#: SC200287
3`UTR clone of replication protein A3 14kDa (RPA3) for miRNA target validation
Product Images
Other products for "RPA3"
Specifications
Product Data | |
Vector | pMirTarget |
Species | Human |
Transfection Reporter | RFP |
Assay Reporter | Luciferase |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Symbol | RPA3 |
Synonyms | REPA3; RP-A p14 |
ACCN | NM_002947 |
Insert Size | 73 bp |
Sequence Data |
>SC200287 3'UTR clone of NM_002947
The sequence shown below is from the reference sequence of NM_002947. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon CAATTGGCAGAGCTCAGAATTCAAGCGATCGC TGACTTCCCTCAGTTTTATCCTTTAGGGATTGTGCAACATGATTGATCTTGATGGATTTTCATACGATTG TAA ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG |
Restriction Sites | SgfI-MluI |
OTI Disclaimer | Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. |
Reference Data | |
RefSeq | NM_002947.3 |
Summary | '' |
Locus ID | 6119 |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.