IRF3 (NM_001571) Human 3' UTR Clone

CAT#: SC200318

3`UTR clone of interferon regulatory factor 3 (IRF3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: IRF3
• Synonyms: IIAE7
• ACCN: NM_001571
• Insert Size: 120 bp
• Sequence Data:
  Insert Sequence

  >SC200318 3'UTR clone of NM_001571
  The sequence shown below is from the reference sequence of NM_001571. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGGACTTGGTGGAGGGCATGGATTTCCAGGGCCCTGGGGAGAGCTGAGCCCTCGCTCCTCATGGTGTGCC
  TCCAACCCCCCTGTTCCCCACCACCTCAACCAATAAACTGGTTCCTGCTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001571.4
• Summary: 'This gene encodes a member of the interferon regulatory transcription factor (IRF) family. The encoded protein is found in an inactive cytoplasmic form that upon serine/threonine phosphorylation forms a complex with CREBBP. This complex translocates to the nucleus and activates the transcription of interferons alpha and beta, as well as other interferon-induced genes. The protein plays an important role in the innate immune response against DNA and RNA viruses. Mutations in this gene are associated with Encephalopathy, acute, infection-induced, herpes-specific, 7. [provided by RefSeq, Sep 2020]'
• Locus ID: 3661