ATP5H (NM_006356) Human 3' UTR Clone

CAT#: SC200325

3`UTR clone of ATP synthase H+ transporting mitochondrial F0 complex subunit d (ATP5H) nuclear gene encoding mitochondrial protein transcript variant 1

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ATP5H
• Synonyms: APT5H; ATP5H; ATPQ
• ACCN: NM_006356
• Insert Size: 87
• Sequence Data:
  Insert Sequence

  >SC200325 3'UTR clone of NM_006356
  The sequence shown below is from the reference sequence of NM_006356. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTATCCCTATTGGCCTCACCAACCAATTGAGAATTTATAAAATTGAGTCCAGGAGGAAGCTCTGGCCCTT
  GTATTACACATTCTGGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006356.2
• Summary: Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. It is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, which comprises the proton channel. The F1 complex consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled in a ratio of 3 alpha, 3 beta, and a single representative of the other 3. The Fo seems to have nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene encodes the d subunit of the Fo complex. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. In addition, three pseudogenes are located on chromosomes 9, 12 and 15. [provided by RefSeq, Jun 2010]
• Locus ID: 10476