MYH (MUTYH) (NM_001048173) Human 3' UTR Clone

CAT#: SC200336

3`UTR clone of mutY homolog (E. coli) (MUTYH) transcript variant gamma3 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "MUTYH"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol MUTYH
Synonyms MYH
ACCN NM_001048173
Insert Size 75 bp
Sequence Data
>SC200336 3'UTR clone of NM_001048173
The sequence shown below is from the reference sequence of NM_001048173. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TCTCCACTGATGCACACAGCCTCAACAGTGCAGCCCAGTGACACCTCTGAAAGCCCCCATTCCCTGAGAA
TCCTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001048173.1
Summary 'This gene encodes a DNA glycosylase involved in oxidative DNA damage repair. The enzyme excises adenine bases from the DNA backbone at sites where adenine is inappropriately paired with guanine, cytosine, or 8-oxo-7,8-dihydroguanine, a major oxidatively damaged DNA lesion. The protein is localized to the nucleus and mitochondria. This gene product is thought to play a role in signaling apoptosis by the introduction of single-strand breaks following oxidative damage. Mutations in this gene result in heritable predisposition to colorectal cancer, termed MUTYH-associated polyposis (MAP). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2017]'
Locus ID 4595

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.