DMAP1 (NM_001034023) Human 3' UTR Clone

CAT#: SC200344

3`UTR clone of DNA methyltransferase 1 associated protein 1 (DMAP1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DMAP1
• Synonyms: DNMAP1; DNMTAP1; EAF2; MEAF2; SWC4
• ACCN: NM_001034023
• Insert Size: 85
• Sequence Data:
  Insert Sequence

  >SC200344 3'UTR clone of NM_001034023
  The sequence shown below is from the reference sequence of NM_001034023. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTTCCGTGAAGAAAGCCAAGAAGCCGTGAGAGGCCCCACGGGGTGTGGGCGACGCTGTTATGTAAATAGA
  GCTGCTGAGTTGGAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001034023.1
• Summary: This gene encodes a subunit of several, distinct complexes involved in the repression or activation of transcription. The encoded protein can independently repress transcription and is targeted to replication foci throughout S phase by interacting directly with the N-terminus of DNA methyltransferase 1. During late S phase, histone deacetylase 2 is added to this complex, providing a means to deacetylate histones in transcriptionally inactive heterochromatin following replication. The encoded protein is also a component of the nucleosome acetyltransferase of H4 complex and interacts with the transcriptional corepressor tumor susceptibility gene 101 and the pro-apoptotic death-associated protein 6, among others. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
• Locus ID: 55929