TAF10 (NM_006284) Human 3' UTR Clone

CAT#: SC200357

3`UTR clone of TAF10 RNA polymerase II TATA box binding protein (TBP)-associated factor 30kDa (TAF10) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "TAF10"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol TAF10
Synonyms TAF2A; TAF2H; TAFII30
ACCN NM_006284
Insert Size 103 bp
Sequence Data
>SC200357 3'UTR clone of NM_006284
The sequence shown below is from the reference sequence of NM_006284. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CAGCGAGTATGGCATCAATGTGAAGAAGCCGCACTACTTCACCTGAGCCACCCAACCTAAATGTACTTAT
CTGTCCCCATGTCCCCACACCAGCCTGTTTTCA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_006284.2
Summary 'Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the small subunits of TFIID that is associated with a subset of TFIID complexes. Studies with human and mammalian cells have shown that this subunit is required for transcriptional activation by the estrogen receptor, for progression through the cell cycle, and may also be required for certain cellular differentiation programs. [provided by RefSeq, Jul 2008]'
Locus ID 6881

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.