IL1RAPL1 (NM_014271) Human 3' UTR Clone

CAT#: SC200359

3`UTR clone of interleukin 1 receptor accessory protein-like 1 (IL1RAPL1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: IL1RAPL1
• Synonyms: IL-1-RAPL-1; IL-1RAPL-1; IL1R8; IL1RAPL; IL1RAPL-1; MRX10; MRX21; MRX34; OPHN4; TIGIRR-2
• ACCN: NM_014271
• Insert Size: 118
• Sequence Data:
  Insert Sequence

  >SC200359 3'UTR clone of NM_014271
  The sequence shown below is from the reference sequence of NM_014271. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGTTGCCAAGGGAGACCAGTATATCCAGTGTGATATGGTGACAGAAAAGCAAGGGACATCCCGTCCCTGG
  GAGGTTGAGTGGAATCTGCAGTCCAGTGCCTGGAACTAAATCCTCGAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_014271.3
• Summary: The protein encoded by this gene is a member of the interleukin 1 receptor family and is similar to the interleukin 1 accessory proteins. This protein has an N-terminal signal peptide, three extracellular immunoglobulin Ig-like domains, a transmembrane domain, an intracellular Toll/IL-1R domain, and a long C-terminal tail which interacts with multiple signalling molecules. This gene is located at a region on chromosome X that is associated with a non-syndromic form of X-linked intellectual disability. Deletions and mutations in this gene were found in patients with intellectual disability. This gene is expressed at a high level in post-natal brain structures involved in the hippocampal memory system, which suggests a specialized role in the physiological processes underlying memory and learning abilities, and plays a role in synapse formation and stabilization. [provided by RefSeq, Jul 2017]
• Locus ID: 11141